Transcript asmbl_21422

Sequence
Transcript Sequence for observation asmbl_21422 of TGE0029628:
CAGAAGTTGAGCAAACATCTCTCCGCTCCATCCCAATTCTGTTGGGACTTCGGGGCCTACCCTGTCCGGACCCGGGAGCTGGGAGGCGGCGAGACCGGTCTGCGCCCCCGAGAGGACGAGTCACCAGGTTTCAAGATGCTGCGAGTACGTAGGACCGAGCTGTGCAGGTTGGGGCTCGGCCTCTCCAGGGGGCTTCACCAACAGCCTGTGATGGCCCTGAGGCGGGAGGACGTGAACGCCTGGGAGAGGAGGGCCCCTCTGGCCCCCAGGCACATCAAGGGGATCACCAACCTGGGATACAAGGTCTTAATACAGCCTTCCAATCGGCGGGCCATTCATGATAAGGAATATGTCAAAGCTGGTGGCATTCTTCAGGAGGATATTTCTGAAGCCTGTCTAATTTTGGGAGTTAAAAGACCCCCAGAGGATAAATTAATGTCCAAGAAGACTTATGCATTCTTCTCCCACACAATAAAGGCCCAGGAGGCCAATATGGGCTTATTGGATGAGATTCTAAGACAGGAAATCCGACTTATTGATTATGAAAAAATGGTGGATCATAGAGGAATTCGGGTAGTGGCGTTTGGACAGTGGGCTGGTGTGGCAGGGATGATCAACATTTTACATGGAATGGGTTTAAGGCTCCTTGCTTTGGGACATCATACACCTTTTATGCACATTGGCATGGCTCATAACTATAGGAACAGCAGTCAGGCTGTGCAAGCTGTCCGTGATGCTGGCTATGAAATATCTCTGGGTTTGATGCCCAAGTCAATAGGGCCCTTAACATTTGTGTTCACAGGGACTGGCAATGTATCAAAGGGAGCCCAAGAAGTCTTCAATGAACTACCCTGTGAATATGTGGAACCACATGAATTAAAAGAAGTTTCTAAAACTGGTGACCTGAGAAAAGTGTATGGAACAGTGTTAAGTCGCCATCATCATCTTGTCAGGAAAACAGATGGTACATATGATCCCGTAGAATATGACAAATATCCTGAGCGCTACATAACTCGTTTTAATACCGATATTGCACCCTATACAACTTGTTTTATTAATGGAATCTACTGGGAGCAAAACACCCCTCGTCTACTAACCCGCCAAGATGCTCAAAGCCTCCTGGCTCCAGTCAAGTCTTCAGTTGTCGGTGTGGAAGGCTGCCCTGCATTGCCACACAAACTTGTGGCAATATGTGACATTTCAGCTGACACAGGAGGGTCTATCGAGTTTATGACCGAGTGTACAACAATAGAGCGTCCTTTTTGCATGTATGATGCAGACCAGCATATTATTCATGACAGTGTTGAAGGCTCTGGGATTCTGATGTGTTCCATTGACAATTTGCCAGCACAGCTTCCAATTGAAGCTACAGAATACTTTGGTGACATGCTTTATCCTTATGTCGAAGAAATGATATTATCAGATGCAACACAGCCTCTTGAAAGTCAGAATTTTTCTCCTGTGGTGAGAGATGCAGTGATTACATCCAACGGTACATTGCCTGATAAGTATAAATATATCCAGAAACTCCGAGAGAGCAGGGAACTTGCTCAGTCACTTTCAATGACTACCAAGAAAAAGGTCTTGGTTCTTGGAAGTGGTTATGTATCTGAGCCTGTACTGGAATATCTGTCGAGAGATGACAACATAGAAATAACAGTAGGCTCTGACATAAAGAATCAAATTGAACAGTTAGGCAAGAAATATAACATTAGTCCTGTTATCATGGACATTGGTAAACAAGAAGAGAAATTGGTCTCCTTGGTGGCAACACAAGATCTTGTCATCAGCTTGTTGCCTTATGTATTGCATCCTCTTGTGGCCAAGGCATGCATCACAAGCAAAGTTAACATGATCACTGCAAGCTATATCACACCAGCACTAAAAGAATTAGAGAAGAGTGTGAAAGATGCTGGCATCACAATCATTGGAGAATTGGGATTGGACCCTGGTCTTGATCACATGTTGGCAATGGAAACAATAGATAAGGCCAAAGAAGTAGGAGCCACGATTGAATCTTATATTTCCTACTGTGGTGGGCTTCCAGCCCCTGAATATTCAGACAATCCTCTGAGATACAAGTTTAGCTGGAGTCCCACGGGAGTCTTGATGAACATAATGCAGCCCGCCACCTACCTCCTCAATGGCAAGGTTGTGAATGTCAAAGGGGGCGTCTCCTTTCTCGATGCGGTTACTCCCATGGATTATTACCCCGGACTAAATTTGGAAGGCTACCCTAACAGAGACAGCACCAAATACGCTGAGGTTTATGGCATTCCCTCTGCTCACACGTTGTTGCGGGGTACACTGAGATATAAGGGATATGCCAAAGCCTTGAATGGGTTTGTGAAATTGGGTCTTATAAACAGAGATGCATTTCCTGCCCTTAGACCTGAAGCCAAGCCTCTCACCTGGGTCTTTCTCATCTCTTGGTTCTATAAAAGAACTCTGGTTGCTACTAGCAACCAGAGCAATAAGCTCCTTTCACTGTATCCTGGCCAAAATGGACTGCTGAAGAGTAAGGCAGAATGAATGAAAAAG