Transcript asmbl_21245

Sequence
Transcript Sequence for observation asmbl_21245 of TGE0029611:
CGCGAGTGTACGCGTTGCCGGCGAAGAGGGGAGCCTGACGACTCGGAAATTTGAATACCACAGTAGCATGGAGTGTGACCTCGTGGAGACTGACATCTTGGAGTCGTTGGAAGATCTAGGTTACAAGGGTCCATTGTTAGAAGATGGCGCTCTGTCTCAGGCAGTCTCTGCTGGAGCCAGTTCCCCTGAGTTTACCAAACTCTGTGCTTGGCTGGTGTCTGAATTAAGAGTGCTCTGTAAACTGGAGGAAAATGTGCAAGCAACTAACAGCCCAGGTGAAGCTGAAGAATTCCAGCTTGAGGTGAGTGGGCTACTAGGGGAGATGAACTGTCCCTATCTTTCACTGACATCTGGGGATGTGACCAAGCGCCTTCTCGTTCAGAAGAACTGCCTCCTTTTGCTCACATACCTCATCTCAGAACTAGAAGCTGCCAGAATGCTCTGTGTGAATACTCCTCCAAAAAAAGCTCAAGAAGGAGGCGGTAGTGAGGTCTTTCAAGAGTTGAAAGGCATATGTATTGCTCTAGGAATGTCCAAACCTCCAGCCAATATAACTATGTTCCAATTCTTCAGCGGGATTGAAAAAAAATTAAAGGAAACATTAGCAAAAGTTCCACCTAATCATGTGGGAAAGCCTTTATTGAAGAAGTCAATGGGACCAGCCCACTGGGAAAAAATAGAAGCAATTAACCAAGCCATAGCCAATGAATATGAAGTTCGGAGAAAGCTGCTAATAAAACGTTTGGACGTCACTGTCCAATCTTTTGGTTGGTCTGACAGAGCTAAGAGTCAGACAGAGAAATTAGCAAAGGTTTACCAGCCAAAACGTTCACTCTTATCTCCTAAAAGTACTATTTCTGTTGCCCACCTTTTGGCTGCAAGACAAGACTTGTCAAAGATTTTAAGGACAAGCAGTGGCTCTGTAAGAGAAAAGACCGCCTGTTCCATCAATAAGGTGCTGATGGGCAGGGTACCTGACAGAGGAGGTAGACCCAACGAAATTGAACCACCGCCCCCAGAGATGCCACCATGGCAGAAAAGGCAAGATGGACCCCAGCAGCAAACAGGAGGCCGAGGAGGAGGGCGAGGTGGTTATGAACAGTCCTCATATGGAGGACGAGGAGGTCATGAACAAGGAGGAGGGAGAGGTGGACGTGGTGGCTACGACCATGGTGGCCGAGGGGGAGGAAGAGGAAATAAGCATCAAGGAGGCTGGACAGATGGAGGGAGTGGAGGAGGAGGTGGCTACCAAGATGGTGGTTATCGAGATTCGGGCTTCCAGCCTGGTGGCTATCATGGTGGCCACAGTGGTGGCTACCAAGGTGGTGGTTATGGTGGCTACCAAACATCTACATATACAGGAAGTGGATACCAGGGTAGTGGCTACCAGCAGGACAATAGATACCAAGATGGCGGGCACCATGGTGATCGAGGCAGTGGTCGCGGAGGGCGGGGTGGCCGTGGAGGCCGAG