Transcript asmbl_23368

Sequence
Transcript Sequence for observation asmbl_23368 of TGE0004308:
CCCTCAGTCGCCGCCGCTGGGGCCGCCACCGCCCGTCCTCGTCGCCCGAGCCCGGACACCATGCCACAGGAAGAGTGACCTCGTCCCTGTTTTCACGATGGAGGACTCGGGAAAGACATTCAGCTCTGAGGAGGAAGAAGCTAACTATTGGAAAGATCTGGCTATGACCTACAAGCAAAAGGCAGAGAATACACAAGAGGAGCTCCGAGAATTCCAGGAGGGAAGCCGAGAATATGAAGCTGAATTGGAGACGCAGCTGCAACAAATTGAGACCAGGAACAGGGACCTCCTGTCAGAAAATAACCGCCTTCGCATGGAGCTAGAAACCATCAAGGAGAAGTTTGAGACACAGCATTCTGAAGGCTACCGTCAGATCTCTGCCTTGGAGGGCGACCTCGCCCAGACCAAAGCCATCAAGGACCAGCTGCAGAAGTACATCCGTGAGCTGGAGCAAGCCAATGACGACCTGGAAAGAGCGAAACGGGCTACGATCATGTCTCTGGAAGATTTTGAGCAGCGTTTGAATCAAGCCATTGAAAGAAACGCCTTCCTGGAGAGCGAACTTGACGAGAAGGAGAATCTCCTAGAGTCTGTCCAGCGGCTGAAGGATGAAGCCAGAGATTTGCGGCAGGAATTGGCTGTGCAGCAGAAGCAGGAGAAACCCAGGACCCCCCTGCCCAACCCGGTGGAAGCCAGCAGGATAGACACTGCTGTGCAGGCCACTGGCTCCGTGCCATCTACCCCTGTGGCCCCCCGGGGACCCAGCTCCAGCTCAGCCACACCGGGGACGTTCAGACGCGGTCTGGAGGACTCCATGGGCGGGACTCCCCTCACACCCGCGGCCCGGATATCAGCGCTCAGCATCGTGGGAGACCTGCTGCGGAAAGTGGGGGCACTGGAGTCCAAACTTGCATCCTGCCGGAACTTCGTGTATGAGCAGTCCCCAAACCGAACAAGCGGCCCGGCCTCAGGACGGGGGAGCAAGAGCAGAGATGGCGGCGACAGACGGCCAGGCAGCACCAGCGCACCTCTGGCTGATAAAGGGTTGGACACCAGTTGCCGCTGGTTGTCCAAATCGACGACCAGGTCGTCCAGCTCCGGCTGAAGCCTGTTCTTGGTCTTTTCCAGTTTGTCA