Transcript asmbl_21155

Sequence
Transcript Sequence for observation asmbl_21155 of TGE0004210:
GGGGGAAGCCGTGCGAGAACCGTCACGTTAGAGCCCGGTTTCTTCTTGGCGGACAGAAATGGACTCAGAAATCAAGGAGGAAATTCCCGTGCATGACGAATACGTTTTATGTGGCGGAGCTGAAACCTGCGTTCTGAAGTGTGGGCCCTGGACTGACCTGTTTAATGATCAGAGCGCCAGCAGACCTAAGCTGCTCATTTTCATTATTCCTGGTAACCCAGGTTTGCCTGCCTTTTATGTACCATTTGCAAAGGCTTTGTACTCTTCAGTAAACAGACGCTTTCCAGTGTGGGTTATCAGTCATGCTGGGCATGTTTTGGCTCCCCAAGACAAGAAGATTCTTACAACCTCGGATGATCCAAATGCTCAAGAAATTAAGGACATCTACGGACTCCGTGGTCAAATAGAACACAAGATAACTTTCCTGAGAACTCATGTGCCAAAGGAAACGAAACTGGTGGTCATTGGCCATTCAGTAGGCTCCTATATTTCCCTTCAGATTTTGAAGCATGCCCCCGAGCTCCCAATAATTCGCTCCTTCCTGCTCTTTCCAACAATTGAGAGACTATCTGAGTCACCCAACGGCAGAATCGCCACTCCGTTATTATGCTGGTTTCGATATGTTTTAAATGTTTTTAGCTACTTGTTATTTAAACCATGTCCGGAGAAAATCAAGTCCTGGTTGCTCAGGACGAGCTGTCAGATAATGAACCTGCAGGATGAATGTTCAGTCCAGAATGTGTTGGAACCTTTCTGCCTTGTTAATATTGCCTATCTCGGTGGCCAAGAAATGATGGAGATAGTAAAGAGAGACAACGAAACCATAAAGGAACATTTGTCTAAGCTTACATTCTACTATGGTGCTAAAGATGCTTGGTGTCCAAAAGAGTACTATGAAGACATAAAGAAAGACTTCCCAGAAGGAGATATTCGACTCTGTGAGAAAAAAATACCTCATGCTTTTATCTTATACTCTTACCAAGAAATGGCCGACATGGTGGCAGACTGGCTTAAGGACGATCTGTCCAAAATTGAAACGGTGACAGAAGAAAACCAGGACTGATAGCTGGCACGTAGAGGCGATAAGTATACTGCCTCTTTGTAGCAAGTAGTGCACTTAGTAGGTAAATGTTTAATTTTGATGTTTAATAATCGGAGAGAAAAAAAGTGAGAACCTCTCGGCTTACAGTCTGCCCACTCCCAGTTCCCCGTGCTACAGTCTGTGGTAAACACGGTTGATGGAATATTCCATAAATTTAACCTCACCTTTTCCAGGACTCACAACATGGAGATCTAGATAGGTCTCTTCCGTTTGCACGAGACGCCCAGTGGCACAGCTTATTTTGGTAGGCAGGATCGTTGCAGACAAAAGGAAGTCTAAATTTAGTTTATTTTAACTGATTTACCTTATAGAATGGCTTCTCCTAGAGGAAATTATTAAATAACTACTAGAAAATGTAAAAGAGATCAGTGAATGTTAAGTGTATAATCAGATATGTGAAGTGTATGAGATCGTGAGAAGGACATACTCATGTACCAACAGCAGGAAGTGATGAGCCATGGATCTTGGCAGCGGACCTGGGTCTCTCTTAAGGACAGAAGTTGAAGATTAGCCCAGACTAACTTCGTAAAGGCCTTGCCTGAGATCATCAGAATCAGGCTGAATACCAGGGCAGCCTGCGCCCACCTGTTCCTACCTTGCAGTACGTCGCAGACCACCAAGTCGGCCTTTTGTCTGAACACCAGTGGCACGAGCCCAAGGAGAGCCAACATTGGGGGAGGTGCTGCTCATCCTCACCTCTGAGAAGCATCCCTGAGGAGTGTGACTCCCTCATCCACCTGCCTTAGACAGGGAATGAGGTTTGACAGCCTTTGCCCTAGTCAACTAACCAGAGAAGAGTCGTTCAAGGATCCTGACTCTGCCTCCCCACCACAAGGCAGCCAGCCAACTCTGTGCCGAGCCTTAGTCTGCCGGACTGTGAGCTCCCTGCATGCTCCTCTTCTCCAGAGCCAGATGCGGAGTCCCTGGACTGTCCCAAATCAATCCTGTATGTACCCACCACATGCAGTTCCTCTTCTGTGATTTTTTCAGTGAAACTCCACTGAGGACCAGCAATGAGCCAAGTACTGTGCTGTGCATTGTGTATAGAGTTCTTAGCTATATTATGGTTCTTTTCTTCTGAAAATCTTCTAGTAAGTAATTTCCAAAAGGGCATCTTTAAATGAGGATTACCATAAATGAGTTCTCCATTTCTGCATTAGCTGTGTTAGTTGGAAATAAATCGTTTTACTAATGAACCAAAACAAATCATTAAATTATGTAAATTCACCTTCTCTGGAAACCTTGAGGTCCAATAGAGAAGAAGCTTGCTCTCTGGCCCAGAGTAGGCTAACAATTTTGCTGCCTTCCCCGAATTGACTCAATCCTGAGGCCTTAGGAGCCAATAAATCCCACTGACTACAGTGATGGTTGACCATGGACCAGAAACATTGGGGTTTTGAAATCCCTCAAACATTATCATTCTTTAAGGACAAGAGGATGTTGGCCTTCCTCTCAAAACCTGAAGCCCCCTGATGAAAGATTCAGGTCTGATATGCTGCCCACACCGCAGTGAGTGTTGAACGAGTTACTCTCTGTCAGGGCCTCCCCATCAGAGCAAGCAACTCCTCGGAGGGGAAGGTCCACGCTCCAGGCATGGAGTATTCTTGGCCGTGGAGAGGAGCCAGGACACTCAGAGGCCATTGGCTCAGGGCTGCACACAAAGTCCTTGTTGGCATCTGTGTGGAAGGTCTAGAAATCTGACGTTAGAGGCTAGAGCTCATGGACACCTCACTGTCCTCACTTATAGGATTAATAATGATAATGCATTAATAATAATGCATACCTCATATTGCTGGAAGAATTAAAGTAGATGATAAAATTAAAGCATTTAGCACAATGCCTGACCAAGAGTATCTTCTGAATAAAGACTGGCTGTAATAATAATTATTATTAAATATCACAGTAATAAAAATGAAAGACTAAGATTTATCAGCAGTGGATGAAATCCATTTTCCAGAAGCATCTCTGCCGGTATGTTCCAGTTAGCCCCATGGCTGGTCCTCGGCAGTAATTTCATACGGAGTTGTCTTCTTCTGTTCTCAGTCTGCTTCGCGCCGTGGGAGAAGATCTCCAGAGACAGGCCCCTGCGCTCGGGCTGATACCCAAGGCAGGCAGGGCCCTCTCTCCGTCTGCTTCTCTCGACCCTTGGAGAGCCAGTGACCTCCAGAGGCTTGATTTTTCTTCACCTTACATTATACATAAGATTAAATTTAATTCCAGATTAAGGGAGACTACAAAGACATGACCACATAATGCAACACCTGATTCTGGATTAGGTGTTTTTGTTACAAAAAGCATTGTTGGGACAATTCGCACGATTTGAATAGGGTCTGAAGTTCAGCTGGGAGTAAGAGATGTTAATTTTCTGATTTCAACGGTAGCGTTGTGGGGGAATAGGGGAATGTTTCTATTTGTAATGACATGCCTGGGGCGATGGGGCAGCTTGTCACTTTACTCTCAAATGGTTCACGGGGAAAAAAACATTCTTTGTACTTGCAACTTTTTTGTAAGTTTGAGATGATTTTGAAATTTATAAAAATAATTATTAAAAAGAAAACCATGCTCTCTC