Transcript asmbl_21110

Sequence
Transcript Sequence for observation asmbl_21110 of TGE0029596:
TTCGGGTCCAACAAAAACAAGCCAGAAGATTATCAGGGTGCCAGGACCAGTGAGGCCATCGTAGATGCTGCTCTCAGCGCTGTGCGCCAGCTCGTAAAGGACCGCCTTGCGGGGAGGGGTGGCGGCTACAGTTCTGGAAGACAAGGTAGAAGTGAAAGCTCAAGCAAGAAAGATGTGATTGAGCTGACCGACGACAGCTTCGATAAGAACGTCCTCGACAGCGATGATGTTTGGATGGTTGAGTTTTATGCTCCTTGGTGTGGACACTGCAAAAACCTAGAGCCAGAATGGGCCGCTGCAGCTACTGAGGTCAAAGAGCAAACGAAAGGAAAAGTGAAGCTGGCAGCTGTGGACGCCACGGCGAACCAGGTTCTCTCCAGCCGATACGGGATTAGGGGATTTCCTACTATCAAGATATTTCAGAAAGGCGAGTCTCCTGTGGACTATGACGGGGGGCGGACAAGGTCCGACATCGTTTCCCGGGCCCTCGATTTGTTTTCTGATAACGCGCCCCCTCCTGAGCTGCACGAGATCATCAGCGAGGACATCGCCAAGAAGACGTGTGAGGAGCATCAGCTCTGCGTGGTGGCCGTGCTGCCGCATATTCTCGATACTGGAGCTGCAGGCAGAAATTCTTATTTGGATGTTCTTCTGAAATTGGCAGACAAATACAAAAAGAAAATGTGGGGGTGGCTATGGACAGAAGCTGGAGCCCAGTCTGAACTTGAGAACGCGCTGGGGATTGGGGGGTTCGGATACCCCGCCATGGCAGCCATCAACGCACGCAAGATGAAATTCGCTCTTCTGAAGGGATCGTTCAGTGAGCAAGGCATTAATGAGTTTCTCAGGGAGCTCTCTTTTGGGCGTGGATCTACGGCGCCTGTAGGAGGGGGCGCGTTCCCCGCCATCAGCACCAGAGAGCCTTGGGATGGCAAGGATGGCGAGCTTCCCGTGGAAGACGACATTGACCTCAGTGACGTGGAGCTGGACGACTTAGAGAGAGATGAGTTGTGAGAGGCTCCGCATAGGCTTCAGTTTTCCTTTCTTGGGAGCGGATTTTCCAGCAGTGACGGAACGTTCTTTACAATCAGATGAATCTTCCAGTGGCCTTTTTAATCGAGAAGTAGCACTTGATTGGTCATTTGAAAACACTGCAACAGTGAACTTTTGCATCTCGAGAAAACAGTGAAAAATTCTATGAATTGTAGCCAGTGAATTGGGTTGTATTCTGTCAAGTAACATTTTGAAAAAACTGATGGGCTATTGAAATACTTTCCTCCCTCTGACTGCTGCTTGAGTGTGCTTGGAGGCTGTTTCTTATGTAAGTTTTTTATGTGATTTCTTTCATTTGAATACTAATGGCTCTTTTCCATTAAAGAATAAATATTTTGGACAATGTCAACAAATGTATGAAATTAGTGTCCACATCGTAAATTCAGCCTGATGTTTAGCCAGTAAATTAATATTATGAAAGGATGACCCCGATGTCTTTCCTTTCTATAAACTTGTGATTCAGATGACACCGTCCGGATGCCTGCCACAACACAGATTTTACATGCGTCCTGCAAGGCCAAGTTCTATCTGTAAATATCAAATGTAAAGCGAGTTTATATAGAAGGATGAAAAAGCAGGGGGTTATCGATTGAGAACTGCGTTTTATGCCCAATATTTTTTCTTTGGGCCATTACCAGTGACTACTAGGGAGTATAGCTGGTTATACAGTTAGCTCAAGGTTTTTCATGTTATTACTAGTCTTCACAAAATGTCCATTAAGACGTGAGATACAGCAGCAGGTCACCAATTTACATGTAGTTCCCATTTATGTAAAACATTCAGGAAATGAAGTTCTGAATTATGTTAGAATATACGTGAAGACACGATTCAAAGGACTTGAGAGCATTTCTTTATTGTAACTTACAAAAAATAAATACAACTGTAACTAACTTTCGTGGGCAGTTTTTCTAAAAAGCTAAGTTCTGGAGGACACCGAAACTGTTCTGCTGAGGGAAGGGAGCGTCTGTCGTCTGCACGGACACGAGGCCAGGTGGTGCCCGCGCGTCATTTCAGTCCAGAAGACTGAGGTCGATGTGGAAGTAGACGTAAGGAAAATAGTCTTGGTTATTGAGTTGCAACCCAGGGATCTCCACCGATGCCTACAAAAGAAGACATGGTAATGTTCCAAGTGCGTAAACCAGCTTCCGGTTTGGCCTTCATATTTCCGAGGAAGCCGTCTAGGCACTGACCATATCATCTGCCCTGCACAGCCCCCCGGCCCCCGGCCCCCACACAACACACACCCACGGCCTCTTCTACGTTCATATTTGTGAAATGTAGGCTTCACAACAGTCCGGCAAGTACCATTTGGTGACAGTATTTCCCACGTGGAGAGGCAGACCTGACTGTAGAAAGCACCTAGTTCGGGGCCATAGACCTACGTCCAGCACACTCGCAGCTGCCACTTCATCCAGATGTCGGAAGACAGAGTTCAGAACCTCTCTTAACCGCTTGGTGGCTGACTTCTTATGAGGCTGGAGGAGCACGGCCTGAAAATTCACTGGGAGTCCGTACCTTCTCAGATAAAATGCGAAAATAAGTTACACAAATGGGTAAAATGACTGGGCAAGAAATACAGAGTTCATTCTAATAAGAATGAAAACCTTCAGCCAGCGTAGCTTGAGAAAACTCAGTTGAGCAGAAGGTCTAGGGTTGGGTAAAACAAATTATTGGATCTTTCTGGAGAGAAAAATCTAGAATATGCTAGCCCACTTGTGACTGAGAGTTCTCGACAAGAGGCTGAGGGGGTCATCCCCAGCCTCATTAGGTGTGAGTGCCCAGGGTGAATGGAGCAATTGGACTGATTGTTCCGACCCAAAGCATTTGTCTAAAACCCGACTTAGCTGATTTTTCTCCACTAAAAGAGCAGCAAAATATATACGATTTATCAAGCTTGTTCTTTTGCTGAGTTTTTGGACAGATAGAAAAGATTTTAAATGGACTTCGTATGCCTGAGTACATTTAAAATCACTTGCCGGCAGCTACTCCTGTGGTGTTGTCCAAGGATAACCGAATACCATAT