Transcript asmbl_17418

Sequence
Transcript Sequence for observation asmbl_17418 of TGE0000438:
CCAGACTGGTCCGTAAGGGTTCCAGGAAGGAATGCAGTTTCAAGAGAACAGTTTGAATCTTTATTCGAATTTGAATTTTGGTACAATGAAGAGAGTCAGCTGCAACTTGACAATCGAAATCTTCAGAAAAGCGACACAAATACGTTCGCCTCGAGGAATATTGGGTCTTCTGCGCGGCCGTAGAGCTCCGCCAAGTGCGCCTGCGCGGAGGAGAAGTGGCGTCGAGTCCGGCCGGGCAGTAGAGGAACTTGCGGTAGTGACCCTCGGGCCTCGCCATGAAGAGCCGCTTTAGCACCATTGACCTCCGCGCCGTACTCGCGGAGCTGAATGCTAGCTTGCTAGGAATGAGAGTAAACAATGTTTATGATGTGGATAATAAGACATACCTTATTCGTCTTCAAAAACCGGACTTTAAAGCTACACTTTTACTTGAATCTGGCATACGAATTCATACAACAGAATTTGAGTGGCCTAAGAATATGATGCCGTCTAGTTTTGCCATGAAGTGCCGAAAACATTTGAAGAGTCGGAGATTAGTCAGTGCAAAACAGCTTGGTGTGGATAGAATTGTAGATTTTCAATTTGGAAGTGATGAAGCTGCTTACCATTTAATCATTGAGCTCTATGATAGGGGGAACATTGTTCTTACAGATTATGAGTACGTAATTTTAAATATTCTAAGGTTTCGAACTGATGAGGCAGATGATGTTAAATTTGCTGTTCGTGAACGCTATCCACTTGATCATGCTAGAGCTGCTGAACCTTTGCTTACTTTGGAAAGGTTGACTGAAATAGTAGCCAGCGCACCTAAGGGTGAACTACTGAAGAGGGTGCTTAACCCATTACTTCCCTATGGACCAGCTCTCATTGAACACTGTCTTTTAGAAAATGGATTCTCGGGTAATGTCAAAGTGGATGAAAAACTTGAAACTAAAGATATTGAAAAAGTACTTGTTTCTCTGCAGAAAGCAGAAGACTATATGAAAACAACATCCAACTTCAGTGGGAAGGGATATATCATTCAGAAAAGAGAAATAAAACCAAGCTTGGAAGCAGATAAACCAGTTGAAGACATACTGACGTATGAGGAATTTCATCCTTTCTTGTTTTCTCAACATTCACAATGTCCATATATAGAATTTGAATCATTTGACAAGGCGGTGGATGAATTTTATTCCAAGATAGAAGGCCAGAAAATTGACTTAAAAGCTTTACAACAGGAAAAGCAAGCATTGAAGAAATTAGATAATGTTCGAAAGGATCACGAAAACAGATTGGAAGCTCTTCAGCAGGCTCAGGAAATAGACAAACTGAAAGGAGAGCTCATAGAAATGAACCTACAAATAGTTGACAGAGCCATTCAGGTAGTTCGAAGTGCTTTAGCTAACCAGATAGATTGGACAGAAATTGGGTTAATTGTGAAAGAAGCCCAGGCTCAAGGAGACCCTGTTGCAAGTGCAATCAAAGAATTAAAACTACAAACAAACCATGTTACAATGCTGCTAAGAAATCCATACTTGTTATCAGAGGAGGAAGATGATGATGTTGATGGTGACGTCAATGTTGAGAAAAATGAAACTGAACCACCAAAAGGAAAAAAGAAAAAACAAAAGAATAAACAGCTGCAGAAGCCTCAGAAAAATAAGCCCTTACTTGTAGATGTTGATCTCAGCTTGTCAGCATATGCCAATGCCAAAAAGTATTATGATCACAAGAGATATGCTGCTAAGAAAACACAAAAGACTGTTGAAGCTGCTGAGAAGGCATTCAAGTCAGCAGAAAAGAAAACAAAGCAAACATTAAAAGAAGTTCAGACTGTTACCTCTATTCAAAAAGCAAGAAAAGTATATTGGTTTGAGAAATTTCTGTGGTTCATTAGCTCAGAGAACTATCTAATTATAGGTGGACGAGATCAGCAACAGAATGAAATAATTGTGAAAAGATACTTGACACCAGGAGACATTTATGTACATGCTGATCTTCATGGAGCTACTAGCTGTGTAATTAAGAATCCAACAGGAGAACCCATCCCCCCACGGACCTTGACTGAAGCTGGCACAATGGCACTTTGCTACAGTGCTGCTTGGGATGCACGAGTTATCACTAGTGCTTGGTGGGTGTACCATCATCAGGTATCTAAAACAGCACCAACTGGAGAATATTTGACAACAGGAAGCTTCATGATAAGAGGAAAAAAGAATTTTCTTCCTCCCTCATATCTAATGATGGGGTTTAGCTTCCTTTTTAAGGTAGATGAGTCTTGTGTTTGGAGACATCAGGGTGAACGAAAAGTCAGAGTACAGGATGAAGACATGGAGACACTGGCAAGTTGTACAAGTGAACTCATATCAGAAGAAATGGAACAATTAGATGGAGGTGACACGAGCAGTGATGAGGATAAAGAAGAACATGAAACTCCTGTGGAAGTAGAACTCATGACTCAGGTTGACCAAGAGGATATCACTCTTCAGAGTGGCAGAGATGAACTAAATGAGGAGCTCATTCAGGAAGAAAGCTCTGAAGACGAAGGAGAATATGAAGAGGTTAGAAAAGATCAGGATTCTGTTGGTGAAATGAAGGATGAAGGGGAAGAGACATTAAATTATCCTGATACTACCATTGACTTGTCTCACCTTCAACCCCAAAGGTCCATCCAGAAATTGGCTTCAAAAGAGGAATCTTCTAATTCTAGTGACAGTAAATCACAGAGCCGGAGACATTTGTCAGCCAAGGAAAGAAGGGAAATGAAAAAGAAAAAACTTCCAAGTGACTCAGGAGATTTAGAAGCGTTAGAGGGAAAGGATAAAGAAAAAGAAAGTACTGTACACATTGAAACTCATCAGAACACAAGCAAAAATGTTGCGGCTGTGCAGCCAATGAAACGAGGACAAAAGAGTAAAATGAAAAAAATGAAAGAAAAATACAAAGACCAGGATGAAGAAGACCGTGAACTTATCATGAAGTTGCTGGGGTCTGCAGGTTCAAACAAAGAAGAAAAAGGGAAGAAGGGGAAGAAAGGAAAAACAAAGGACGAACCTGTGAAGAAACAGCCCCAGAAACCTAGAGGTGGACAGAGGGTCTCTGACAACATTAAGAAAGAAACTCCGTTCCTTGAGGTTATAACTCATGAGTTACAAGACTTTGCTGTAGATGATCCACATGATGACAAGGAAGAGCAAGATCTGGATCAACAGGGAAATGAGGTATGATTTTATGTTGGGGTTCCTACTACAACACTGTGATTACAATTCAGTTCCCA