Transcript asmbl_20620

Sequence
Transcript Sequence for observation asmbl_20620 of TGE0004203:
CACTAACCACGTCCTCCGAGCCCTGCCTGCCGCAGGTTTCCAATAGCTTCTGCACACCGGAACTCAGGTGGAGCAGAGACCCAGAAGTCCTGCGCTGTTTGGTGAGCGTGTACGCATAGCGCAATCTCGCGTGCTGGCCCGGGGCGAACAGAGCTGCCAGATACTTTGTTGTAAGAAATTGAACATGGCAGAAGAAGAGGACTATATGTCTGATTCCTTCATTAACGTCCAAGAAGATATCAGACCGGGATTGCCAATGCTGAGGCAAATTCGAGAAGCTCGTCGAAAAGAAGAAAAGCAGCAGGAAGCTAATTTGAAAAATAGGCAGAAGAGTTTAAAAGAAGAAGAACAAGAAAGACGTGACATTGGGTTGAAGAATGCACTAGGCTGTGAAAACAAAGGGTTTGCTTTGCTCCAAAAGATGGGATATAAAAGTGGCCAGGCCCTTGGCAAGAGTGGAGATGGTATTGTTGAACCAATTCCTCTCAATGTCAAAACAGGGAAAAGTGGCATTGGTCATGAGGCATTGTTAAAACGGAAAGCAGAGGAAAAATTAGAAAGCTACAGAAGAAAGATTAATGTGAAAAAGCAAACTGAAGAAAAAGCTGCAGAACAGTTTCGAATGCGACTTAAAAATAAGCAAGATGAAATGAAGCTAGAAGGAGATCTTAGAAGAAGCCAGCGAGCCTGTCAACAATTGGATACTCAGAAGAATATTCAGGTTCCCAGGGAGGCCTGGTACTGGTTGAGGCTTGAAGAAGAGACTGAAGAAGAGGAAGAGGAAGAAAAAGAACAAGATGAAGATGAATATAAGAGTGAAGATTTAAGTGTACTGGACAAATTACAAATATTGACTAGTTATTTAAGAGAAGAACATCTGTATTGTATTTGGTGTGGAACAGCCTATGAAGATGAAGAAGACCTGTCTTCACATTGCCCAGGACCAACTTCCGCAGATCACGACTAAGAGTAGTCTCAATAAAGTAGAAATCTGGAAAATGCTGTTATTCTCAAAGACAGATAGTTGAGCAGTTAGAATTCCCAGATTTTGGACACCAGTAAAGAAAGAGGGCCTTATATATTTTGTTCTTTTTCTACTTTCGAAGTCCTTCATACTTTAGAATTGTTCACTGACCTCCAAAAATATAATGGAATGCTATTTCAGAACATGAGTTATAGACACGGGCCATTACAATTTATGACTCTGTTGTGATACTTATGGAGTTTAAGGGACACCAGCAGGTAACTCCCTTATTCCTCTCTTCACTTCAGAACAAATTGAAAAATAAGACATGGGAGCCAGCTTTATTATCAGTGAAGCTGAAATAGACGGCAAGGCTGATTTGTTCTCTAGTCAGACTCCCTAACATAGCTCTGTGATTGGAGAGACTGCAGACCTCGGTGAGAACACAGCCCATTTCACATTTTCAGACTAGTT