Transcript asmbl_20561

Sequence
Transcript Sequence for observation asmbl_20561 of TGE0004192:
CACAGTTCGGTTGCGCTGCGGAGCGCAGCTGTGAGGGAGTCTGTCTGGTCCGCGGCCCCAGAACCCGAGCTGAAGCGGTAGCGCAGGCTGCGGGAAGCTGAGTCGGAAGGCCTGAGTGTTTGTTCAAGCATGTCGGAAGGGGAGTCCCAGACAGTACTCAGCAGTGGCTCAGACACAAAGGTAGAATCCTCATCTTCAGCTCCTGGCCTGACATCAGTGTCACCTCCTGTGACCTCCACAACCTCAGCTGCTTCCCCAGAGGAAGAAGAAGAAAGTGAAGATGAGTCTGAGATCTTGGAAGAGTCACCCTGTGGGCGCTGGCAGAAGAGGCGAGAAGAGGTAAATCAGCGGAATGTACCAGGTATTGACAGTGCATACCTGGCCATGGATACAGAGGAGGGTGTAGAGGTTGTGTGGAATGAGGTACAATTCTCTGAGCGCAAGAACTACAAGCTGCAGGAGGAAAAGGTCCGTGCTGTATTCGATAATCTGATTCAATTGGAACATCTCAACATTGTTAAGTTTCACAAATATTGGGCTGACATTAAAGAGAACAAGGCCAGGGTCATTTTTATCACAGAATACATGTCATCTGGGAGTCTTAAGCAATTTTTGAAGAAGACCAAAAAAAACCACAAGACTATGAATGAAAAGGCTTGGAAGCGCTGGTGCACACAGATCCTCTCTGCCCTAAGCTACCTGCACTCCTGTGACCCCCCCATCATCCATGGGAACCTGACCTGTGACACCATCTTCATCCAGCACAACGGACTCATCAAGATTGGCTCTGTGGCTCCTGACACTATCAACAATCATGTGAAGACTTGTCGGGAAGAACAGAAGAATCTACACTTCTTTGCACCAGAGTATGGAGAAGTCACTAATGTGACAACGGCAGTGGACATCTATTCCTTTGGCATGTGTGCACTGGAGATGGCAGTGCTGGAGATTCAGGGCAATGGAGAGTCCTCATATGTGCCACAGGAAGCCATCAGCAGTGCCATCCAGCTTCTAGAAGACCCATTACAGAGGGAGTTCATTCAAAAGTGCCTGCAGTCTGAGCCTGCTCGCAGACCAACAGCCAGAGAACTTCTGTTCCACCCAGCACTGTTTGAAGTGCCCTCACTCAAACTTCTTGCTGCCCACTGCATTGTGGGACACCAACATATGATCCCAGAGAATGCGCTGGAGGAGATCACCAAAAACATGGATACCAGTGCTGTACTGGCTGAAATCCCTGCTGGACCAGGAAGAGAACCAGTTCAGACTTTGTACTCTCAGTCACCAGCTCTGGAATTAGATAAATTCCTTGAAGATGTCAGGAATGGGATCTACCCCCTGACAGCCTTTGGGCTGCCTCGGCCCCAACAGCCACAGCAGGAGGAGGTGACATCACCTGTGGTGCCGCCTTCTGTCAAGACTCCAACACCTGAACCAGCTGAGGTGGAGACCCGAAAGGTGGTGCTGATGCAATGCAACATTGAGTCAGTGGAGGAGGGAGTCAAACACCACCTAACACTTCTGCTGAAGCTGGAGGACAAACTGAACCGGCACCTGAGCTGTGACCTGATGCCAAATGAGAACATCCCTGAGTTGGCAGCTGAGCTGGTGCAGCTGGGCTTCATAAGTGAGGCTGACCAGAGCCGGCTGACTTCTCTGCTAGAAGAGACCCTGAACAAGTTCAATTTTGCCAGGAACAGCACCCTCAACTCAGCCGCTGTCACCGTCTCCTCTTAGAGCTCACTTGGGCCAGGCCTCTAATCTGAGCTGTGGCTGTCACTAGATATGCTGCAGCCTTCCTGCCCCTCCCCCCCAGTCAGTATTACCCTGTGAAGCCCCTTCTCTCCTTTATTATTCAGGAGGGCTTTGGGGCTCCCTGGTTCTGAGCATCACCCTACCCCTTCCCCTTTTATTCCTCCCCTCAGCACTTTGTTTACTTGTTTTGCACAGACGGGGGCCTGGGCCTTCTCAGCAGCCGCCTTCTAGTTGGGGGCTAGTAGCTGATCTGCCGGCTCCTGGCCTGCCTGTGTGGAAAGGGGGCCCACGGGCGCTGGGGGAGCCGAATTCTACAATCCCGCTGGGGCGGACGGGGCGGGAGAGAAGGGTGGTGCTGCAGTG