Transcript asmbl_20339

Sequence
Transcript Sequence for observation asmbl_20339 of TGE0004161:
GTCGCAGGGCCCAACATCTGTACCACACGCGGTGTGAGCTCCTGCCAGCAGTGCCTGGCCGTGAGTCCCATGTGTGCCTGGTGCTCAGATGAGGCCCTGCCTCTGGGCTCTCCCCGCTGCAACCTGAAGGAGAATCTGCTGACGGATAACTGTGCCCTGGAGTCCATCGAGTTCCCCATCAGTGAGGCCAGCATCCTGGAGGCCAGACCCCTCAGTGACAAGGGCTCTGGAGACAGCTCTCAGATTACTCAAGTCAGTCCCCAGAGGATTGCGCTCCGGCTCCGGCCAGATGATTCGAAGAGTTTCTCCGTCCAGGTCCGGCAGGTGGAGGATTACCCTGTGGATATCTACTACTTGATGGACCTGTCTTACTCCATGAAAGATGACCTGTGGAGCATCCAGAACCTGGGTACCAAGCTGGCTTCCCAGATGCGCAAGCTCACCAGTAACTTACGGATTGGCTTTGGGGCCTTTGTGGACAAACCCGTGTCACCATACATGTACATCTCCCCACCAGAGGCCCTCAAAAACCCCTGCTATGATATGAAGACCACCTGTTTGCCCATGTTCGGCTACAAACATGTGCTCACACTGACTGACCAGGTGACCCGCTTCAATGAGGAGGTGAAGAAGCAGAGTGTGTCACGGAACCGAGATGGCCCAGAGGGCGGCTTTGATGCCATCATGCAGGCGACAGTCTGTGATGAGAAGATTGGCTGGAGGAATGATGCATCCCACTTGCTGGTGTTTACCACTGATGCCAAGACCCATATAGCACTGGATGGAAGGTTGGCAGGCATTGTCCAGCCCAATGATGGGCAGTGTCACGTTGGCAGTGACAACCATTACTCTGCCTCTACTACCATGGATTATCCCTCTCTGGGGCTGATGACTGAGAAGTTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAGAAGTAGTCAATCTCTACCAGAACTACAGTGAGCTCATCCCAGGGACCACAGTGGGAGTTCTGTCCACCGATTCCAGCAATGTCCTACAGCTCATTGTTGATGCTTATGGGAAAATCCGCTCCAAAGTAGAGCTGGAAGTGCGTGACCTTCCTGAGGAGTTGTCTCTGTCCTTCAATGCTACTTGTCTCAACAACGAGGTCATCCCAGGCCTCAAGTCTTGTGTTGGACTCAAGATTGGAGACACGGTGAGCTTCAGCATCGAGGCCAAGGTGCGTGGCTGCCCCCAGGAGAAGGAAAAGTCCTTCGCCATCAAGCCTGTGGGCTTTAAAGACAGTCTCACTGTGCAGGTCACCTTCGACTGTGACTGTGCCTGCCAGGCCCATGCCGAGCCTTACAGCCGCCACTGCAACAACGGCAATGGGACCTTTGAGTGTGGGGTGTGCCGCTGTGGGCCTGGCTGGCTGGGATCCCAGTGTGAGTGCTCAGAAGAGGACTACCGCCCCTCGCAGCAGGATGAGTGCAGCCCCCAAGAGGGCCAGCCAGTCTGCAGCCAGCGGGGCGAGTGCCTCTGTGGCCAGTGCGTCTGCCACAGCAGTGACTTTGGCAAGATCACGGGCAAGTACTGTGAGTGTGATGACTTCTCCTGTGTCCGCTACAAGGGGGAGATGTGCTCGGGACATGGCCAGTGCAGCTGTGGGGACTGCCTGTGTGACTCCGATTGGACCGGCTACTACTGCAACTGTACCACACGCACGGACACCTGCATGTCCAGTAATGGGCTGCTGTGCAGCGGCCGGGGCAAGTGTGAATGTGGCAGCTGCATCTGCATCCAGCCAGGCTCCTACGGGAACACCTGTGAGAAGTGTCCCACCTGCCCTGATGCCTGCACCTTTAAGAAGGAGTGTGTAGAGTGTAAGAAGTTCAACCGGGGAACCCTGCTCGAGGAAAATACCTGCAACAGTTACTGTCGTGATGAGATCGAGTCTGTGAAGGAGCTCAAGGACACTGGCAAGGATGCAGTGAATTGTACCTATAAGAATGAGGATGACTGTGTCATCAGGTTCCAGTACTATGAAGACTCCAGTGGAAAGTCTATCCTATATGTGGTAGAAGAGCCAGAGTGTCCCAAGGGCCCCGACATCCTAGTGGTCCTGCTTTCAGTGATGGGGGCCATTCTGCTCATCGGCCTTGCTACTCTGCTCATCTGGAAGCTCCTCATTACCATTCATGATCGGAAGGAATTTGCAAAATTTGAGGAAGAGCGAGCCAGAGCAAAATGGGACACGGCCAACAACCCACTGTATAAAGAAGCCACATCCACCTTCACCAACATCACCTACCGGGGCACTTAATGGCAAAGTAGTCGTCCTCCGATCACTATCAGACTGTCCCAGGATTGTGGGCATCTCTGCTGTCGTGTTTACAGGAGACAATATCTGTGGGGTGGGATTG