Transcript asmbl_19725

Sequence
Transcript Sequence for observation asmbl_19725 of TGE0004149:
GCCATTTTGTTCTTCTCGTGGTTCCAGTGGGGAGAGAAGGAGGAAGCAGGGTGCGGGGCGGTCGGGGGGGGACCCGCCGCGGCTGTTGCCACCGCCGCCACCACCGCCTCTGTGCTCGTGGCGTGGGAAAGGAGGCGTGAGTCCCGGGCGCGAGCCGCCGGCGGCGCCGCTACGGGAGGATCGGTGGTGGGAAGGCGATGGCGGATATAGATAAACTCAATATCGACAGCATCATCCAACGGCTGCTGGAAGTGAGAGGGTCCAAGCCTGGTAAGAATGTCCAGCTACAGGAGAATGAAATCAGAGGATTGTGCTTAAAGTCCCGAGAGATCTTTCTCAGTCAGCCTATCCTACTAGAACTTGAAGCACCACTCAAAATATGTGGTGATATCCATGGGCAGTACTATGATTTGCTTCGACTTTTTGAGTACGGTGGTTTCCCACCCGAAAGCAACTACCTGTTTCTTGGGGACTATGTGGACAGGGGGAAGCAGTCATTGGAGACTATCTGCCTTTTATTGGCGTACAAAATCAAATATCCCGAGAATTTTTTTCTTCTCAGAGGAAACCATGAATGTGCCAGCATCAATAGAATTTATGGATTTTACGATGAATGTAAAAGAAGATATAACATTAAACTATGGAAAACTTTCACAGACTGCTTTAATTGTTTACCAATAGCAGCCATCGTGGATGAGAAAATATTTTGCTGTCATGGAGGTTTATCACCAGATCTTCAATCTATGGAGCAGATTCGGCGAATTATGCGACCAACTGATGTACCAGATCAAGGTCTTCTTTGTGATCTTTTGTGGTCTGACCCCGATAAAGATGTCTTAGGCTGGGGTGAAAATGACAGAGGAGTGTCCTTCACATTTGGTGCAGAAGTGGTTGCAAAATTTCTCCATAAGCATGATTTGGATCTTATATGTAGAGCCCATCAGGTGGTTGAAGATGGATATGAATTTTTTGCAAAGAGGCAGTTGGTCACTCTGTTTTCTGCACCCAATTATTGTGGAGAGTTTGACAATGCAGGTGCCATGATGAGTGTGGACGAAACACTAATGTGTTCTTTTCAGATTTTAAAGCCTGCAGAGAAAAAGAAGCCGAATGCCACAAGACCTGTAACACCTCCAAGGGGTATGATCACAAAGCAAGCAAAGAAATAGATGTCATTTTGACACTGCCTAGTTGGGACTTGTAACATATAGTATATAACCTTCATTTTTAAAACTGTAATGTGTATTGGTCAGCTTGCTCAAACAGTGTGTTTGTGGGGCCCTCCCTTCCATTTTTGACTTAATGAATGGCATTTGCTGGTTATAACAGCAAATGAAAGATTCTCTACTCCCAAGAAACAATATTTTGTTTTTAATTCTCTATTCCTTTTACAAACAATTTTAATGATGGTGTTAAAGCTGTATGCCCCAGGATGGTTTATCCTGTCTGAGGGGTAAGTGTACAATTGACCTTTTTTTTTTAATTCAGTACAGCCCATGAATCATGTAAATGCTCGTTTTCTTTAGGATATAAAGAGAGCCCTAGGGTGCTCAATCTGTACATGTTATCGTCATAAAATGCATACTGTTGATACAGACCACTGTGAACATTTTTTTAATTTTAAGATTTTGTTTCAAAGGGATTGCTTATTTCTCTCATTGTCTTGTCATGTACAAATTGGTTTTTATTGCTATCAACATTAGAAGTAACTTTCAACCTTGCCAGCATCACTGGTATAATGTATGTTTAATTAAAGCACACTTTCCTCTACCGAATACTTAAAACGAGAATTAAAGCCATTATTTTAAATGTTTGTGACTCTTTCCTAAAGCCAAAGTTTCTGTTGAAATACGTATTGACACACCCCTAAGAACAAAATGGCATAGTTTTATACCCATGCCGCCTTGTTGGGGATTCAAAAACAGGTTTTTGAGTTAAAATAGCAATTAGTAATATAGTGCAGTTTAAGCTATTAATGATTAAAGTTAATAACATTTTGTACAATTTCCATATAGTCTATTCATTAATCTTTTTACAGTTGCATCAGGCCTGAACCCGTCCATTCAGAAAGCTTCAAATTATAGAAACAATACTGTTCTATACGAGTGACCGATTATGCTTTCTTTGGCCTACACTCTTTATTCTGCGGTGAAATTGAGGCTTATAAGTCAAACAAAGGAACTAACTTACTATCCACCAGTTTATACAGAACTCACAGTATCTATGACTTTTTTAAAACTAAGATCTGTTAAAAAGAAATCTGTTTCAACAGATGACCGTGTATAATACCATGTGGTGAAAGTGAATTCAGACTTATTAAATGATGAACTTGTTAAATCCTCTCAGTGTCTATTTATCAGCACAATACACACAGGAGAACTGTTGATGGCATATTAAATCGATTTTAATGAATAAATGGCTCTGGAAACCA