Transcript asmbl_19568

Sequence
Transcript Sequence for observation asmbl_19568 of TGE0004133:
AGGCGGGAACCACTGTCCCTGGTCAACGTGCGGAAGAGGAGCCTGGAATCTGGAGACGACGACCTGCCGACCAGGATGGACCACTACAAAGCCAAGGCTACGCGGCACATCTTCCTCATCAGGCACTCGCAGTACCACGTGGACGCGTCCCTGGAGAAGGACCGCACTCTGACGCCCCTGGGTCGTGAGCAGGCTGAGTTGACTGGTCTCCGACTTGCAAGCCTGGGGTTGAAGTTTAATAAAATCGTGCATTCCTCCATGACCCGTGCGGTGGAAACCACCGACATCATCAGTAAACACCTGCCAGGTGTCTCCACGGTCAGCACAGACCTGCTGAGGGAAGGTGCCCCCATCGAGCCCGACCCGCCCGTGTCGCACTGGAAGCCGGAGGCTGTGTATTACGAGGACGGGGCCCGGATTGAGGCTGCCTTCCGCAGTTACATCCACCGGGCAGACACCAAGCAGCAGGAGGACAGTTACGAGATCTTCATCTGCCATGCCAACGTCATCCGCTACATCGTGTGCCGGGCGCTGCAGTTCCCTCCGGAAGGCTGGCTCCGTCTCTCCCTCAACAATGGCAGCATCACCCACCTGGTGGTCCGGCCTGATGGCCGAGTGGCACTCAGGGCTCTTGGGGACACGGGCTTCATGCCTCCCGACAAGATTTCCCGCTCCTGAGGCCGCTGCGAGGCCAGTGCCTGGCTCTGCTGCGGGAGCCGGGAACAAGGGCCGTGTCCCCTGCCTTCCGTCCGCAGGTGGCACTGCGGTCGCTGTTTCTCCAGGATGAGGCTGCGGAGTGGAAACACCTGCCACACGGCACATCGTCATCCTCCTGCCCAGAGTGGCAGGGGGCGCTCGGGCCCCGCTGCCGGGTCTCCCCAGGTCCTCTGCCCCAGGCTCACCTACTAGGATGGGCCTGTGGGGGTGGAGGCCCCGCGGGGCCCTGCAGGTGTGCACCGGGGCCTGTGGCCAGGACCGCGACCGCAAGAGGCAGCGAGCCCATCAGGCTGAGGGCGTCAGGAGGGCCCGGCGCTTCCATCCTAATGTCTTTGCTTCGTACGTTCTTTTTGTAAGATCCTCTCGTCACTTATGTTAAAGACTTTCCTCACCTGGGTTCTTTTCTGAAAACCGATTCCTCGCTCCGGAGTTACGCACCCCTGATGCTACTGCATCTGAACTCACGTGTCTTCAAGGCCTTTGCGGACATGGGCACCCAGGCAGGTGGTGGGGGCCAGGGGGAGAGGGTCCTGTTTAAAATATCCAGCTGATGGCTGAATCTTTGTTTGCCTCTAGCTGTTAATCTTTTATGCTTATGGATGAAAACATTTAGACACGACATGTCCATCATAAGTATTCTGTTAATTTACCAAAAACCCTACAATTTCTGCGAAGTGGTTATGGACATTTTCTGCTGTGATCAGTGCAACTGAGATATTTGATCCATTTCTGTTAACTTGGAAATAACTA