Transcript asmbl_19548

Sequence
Transcript Sequence for observation asmbl_19548 of TGE0004130:
CCTGGGCCTGTCTCTGGGCCGTGGGGGGAGGCAAAGCTGAGTGAGGCTCCACCAGCAGGTGCTGCTTCAGGCAGCTGCTCGCGGTGGGGTCTCCCTGGCTCAGAGCATGATGCCTCGCTGTCCTGTATCAAGCAGCTGCCAATGTGCTGCTCTCGGAGCAAGGCGACGTGAAGCTGGCGGACTTCGGGGTGGCAGGGCAGCTCACGGACACGCATATCAAGAGGAACACGTTCGTGGGCACCCCGTTTTGGATGGCGCCCGAGGTCATCAAGCAGTCAGCCTACGACTTCAAGGCTGACATCTGGTCACTGGGGATCACGGCCATTGAACTGGCCAAAGGTGAGCCTCCGAACTCTGACCTCCACCCCATGCGCGTCCTGTTCCTGATCCCCAAGAACAGCCCGCCCGTGCTAGAGGGCCACCACAGCAAGCCCTTCAAGGAGTTTGTGGAGGCCTGCCTCAACAAGGACCCCCGATTCCGGCCCACGGCCAGAGAGCTCCTGAAGCACAAGTTCATCACGCGCTACACCAAGAAGACGTCCTTCCTCACCGAGCTCATCGACCGCTACAAGCGCTGGAAGTCTGAGGGCCACGGCGAGGAGTCCAGCTCAGAGGACTCTGACATTGATGGGGATGCTGAGGATGGGGAGCAGGGCCCCATCTGGACGTTCCCCCCCACCATCCGGCCAAGCCCGCACAGCAAGCTGCACAAGGGGTCAGCGCTGCACGGCCCCCAGAAGTCTGCTGAGCCTGCCAAGAGGCAGCCGAGGTCCCAGTGCCTGTCCACGCTGGTCCGGCCTGTCTTCGGAGAGCTCAGAGAGAAGCACCGGCAGAGCGGTGGGGGCGTGGGGGCGCTGGAGGAGCTGGAGAACGCCTTCAGCCTGGCCGAGGAGTCCTGCCCCGGCATCTCGGACCAGCTGATGGCCCACTTGGTGGAGCGGGTGCAGCGGTTTTCACACAACAGAAACCACCTGACGTCCAGCCGCTGAAGCCGCCGTGGACGGGGAGCGGGCAGGGTGGCCTTCGTTTTGAGCTCTGTAGGGTCCTCGCTGACTTGGAGCCCTTTGCACCGTGTCACGGCCTCACCGCTGGGTCTCAGCCCCTACCCTGTGCGGAGGGCTGTCCCCCGTCCCTTCCTGGCTGGGCTGAGGTTACAGCTGGCAGCAGAGACCCCCTGGAGAACCAAGTGACCCTGTGGGGGCAGCGGGCTCGGTCCCCTCAGGCCTCCTTGGCAGGGCCGTCCCCTCCCCCAGGCTCACTGGGTGCAGCTGCTTGGATGGGGGTGTGGAGCCTGTCAGCCCAGCCCTTCCCTTGCCCAGGGCCATAGTGGCCGTGGATTTGCCTTGTGGTGTGAGACCAGGTGCCGTGTCTTCTCGTAAGCGCACGCGTCAGCCAGAACATTTTGTATTTTAAGAAAACTGAACTCTGCTTTCCTGTATCTTCCGAAGTTAAGGTGTTGGTCTCACGGGACGTGGAGAGGCTCCTGCCCCTTTCAATAAACACCTGAATTGAGCTGCACTGGTG