Transcript asmbl_17417

Sequence
Transcript Sequence for observation asmbl_17417 of TGE0000437:
CCAGACTGGTCCGTAAGGGTTCCAGGAAGGAATGCAGTTTCAAGAGAACAGTTTGAATCTTTATTCGAATTTGAATTTTGGTACAATGAAGAGAGTCAGCTGCAACTTGACAATCGAAATCTTCAGAAAAGCGACACAAATACGTTCGCCTCGAGGAATATTGGGTCTTCTGCGCGGCCGTAGAGCTCCGCCAAGTGCGCCTGCGCGGAGGAGAAGTGGCGTCGAGTCCGGCCGGGCAGTAGAGGAACTTGCGGTAGTGACCCTCGGGCCTCGCCATGAAGAGCCGCTTTAGCACCATTGACCTCCGCGCCGTACTCGCGGAGCTGAATGCTAGCTTGCTAGGAATGAGAGTAAACAATGTTTATGATGTGGATAATAAGACATACCTTATTCGTCTTCAAAAACCGGACTTTAAAGCTACACTTTTACTTGAATCTGGCATACGAATTCATACAACAGAATTTGAGTGGCCTAAGAATATGATGCCGTCTAGTTTTGCCATGAAGTGCCGAAAACATTTGAAGAGTCGGAGATTAGTCAGTGCAAAACAGCTTGGTGTGGATAGAATTGTAGATTTTCAATTTGGAAGTGATGAAGCTGCTTACCATTTAATCATTGAGCTCTATGATAGGGGGAACATTGTTCTTACAGATTATGAGTACGTAATTTTAAATATTCTAAGGTTTCGAACTGATGAGGCAGATGATGTTAAATTTGCTGTTCGTGAACGCTATCCACTTGATCATGCTAGAGCTGCTGAACCTTTGCTTACTTTGGAAAGGTTGACTGAAATAGTAGCCAGCGCACCTAAGGGTGAACTACTGAAGAGGGTGCTTAACCCATTACTTCCCTATGGACCAGCTCTCATTGAACACTGTCTTTTAGAAAATGGATTCTCGGGTAATGTCAAAGTGGATGAAAAACTTGAAACTAAAGATATTGAAAAAGTACTTGTTTCTCTGCAGAAAGCAGAAGACTATATGAAAACAACATCCAACTTCAGTGGGAAGGGATATATCATTCAGAAAAGAGAAATAAAACCAAGCTTGGAAGCAGATAAACCAGTTGAAGACATACTGACGTATGAGGAATTTCATCCTTTCTTGTTTTCTCAACATTCACAATGTCCATATATAGAATTTGAATCATTTGACAAGGCGGTGGATGAATTTTATTCCAAGATAGAAGGCCAGAAAATTGACTTAAAAGCTTTACAACAGGAAAAGCAAGCATTGAAGAAATTAGATAATGTTCGAAAGGATCACGAAAACAGATTGGAAGCTCTTCAGCAGGCTCAGGAAATAGACAAACTGAAAGGAGAGCTCATAGAAATGAACCTACAAATAGTTGACAGAGCCATTCAGGTAGTTCGAAGTGCTTTAGCTAACCAGATAGATTGGACAGAAATTGGGTTAATTGTGAAAGAAGCCCAGGCTCAAGGAGACCCTGTTGCAAGTGCAATCAAAGAATTAAAACTACAAACAAACCATGTTACAATGCTGCTAAGAAATCCATACTTGTTATCAGAGGAGGAAGATGATGATGTTGATGGTGACGTCAATGTTGAGAAAAATGAAACTGAACCACCAAAAGGAAAAAAGAAAAAACAAAAGAATAAACAGCTGCAGAAGCCTCAGAAAAATAAGCCCTTACTTGTAGATGTTGATCTCAGCTTGTCAGCATATGCCAATGCCAAAAAGTATTATGATCACAAGAGATATGCTGCTAAGAAAACACAAAAGACTGTTGAAGCTGCTGAGAAGGCATTCAAGTCAGCAGAAAAGAAAACAAAGCAAACATTAAAAGAAGTTCAGACTGTTACCTCTATTCAAAAAGCAAGAAAAGTATATTGGTTTGAGAAATTTCTGTGGTTCATTAGCTCAGAGAACTATCTAATTATAGGTGGACGAGATCAGCAACAGAATGAAATAATTGTGAAAAGATACTTGACACCAGGAGACATTTATGTACATGCTGATCTTCATGGAGCTACTAGCTGTGTAATTAAGAATCCAACAGGAGAACCCATCCCCCCACGGACCTTGACTGAAGCTGGCACAATGGCACTTTGCTACAGTGCTGCTTGGGATGCACGAGTTATCACTAGTGCTTGGTGGGTGTACCATCATCAGGTATCTAAAACAGCACCAACTGGAGAATATTTGACAACAGGAAGCTTCATGATAAGAGGAAAAAAGAATTTTCTTCCTCCCTCATATCTAATGATGGGGTTTAGCTTCCTTTTTAAGGTAGATGAGTCTTGTGTTTGGAGACATCAGGGTGAACGAAAAGTCAGAGTACAGGATGAAGACATGGAGACACTGGCAAGTTGTACAAGTGAACTCATATCAGAAGAAATGGAACAATTAGATGGAGGTGACACGAGCAGTGATGAGGATAAAGAAGAACATGAAACTCCTGTGGAAGTAGAACTCATGACTCAGGTTGACCAAGAGGATATCACTCTTCAGAGTGGCAGAGATGAACTAAATGAGGAGCTCATTCAGGAAGAAAGCTCTGAAGACGAAGGAGAATATGAAGAGGTTAGAAAAGATCAGGATTCTGTTGGTGAAATGAAGGATGAAGGGGAAGAGACATTAAATTATCCTGATACTACCATTGACTTGTCTCACCTTCAACCCCAAAGGTCCATCCAGAAATTGGCTTCAAAAGAGGAATCTTCTAATTCTAGTGACAGTAAATCACAGAGCCGGAGACATTTGTCAGCCAAGGAAAGAAGGGAAATGAAAAAGAAAAAACTTCCAAGTGACTCAGGAGATTTAGAAGCGTTAGAGGGAAAGGATAAAGAAAAAGAAAGTACTGTACACATTGAAACTCATCAGAACACAAGCAAAAATGTTGCGGCTGTGCAGCCAATGAAACGAGGACAAAAGAGTAAAATGAAAAAAATGAAAGAAAAATACAAAGACCAGGATGAAGAAGACCGTGAACTTATCATGAAGTTGCTGGGGTCTGCAGGTTCAAACAAAGAAGAAAAAGGGAAGAAGGGGAAGAAAGGAAAAACAAAGGACGAACCTGTGAAGAAACAGCCCCAGAAACCTAGAGGTGGACAGAGGGTCTCTGACAACATTAAGAAAGAAACTCCGTTCCTTGAGGTTATAACTCATGAGTTACAAGACTTTGCTGTAGATGATCCACATGATGACAAGGAAGAGCAAGATCTGGATCAACAGGGAAATGAGGAAAACCTATTTGATTCTTTGACAGGCCAGCCACATCCTGAAGATGTACTACTGTTTGCCATTCCAATATGTGCCCCTTACACCACCATGACAAACTACAAATATAAAGTGAAACTTACTCCTGGAGTGCAGAAAAAGGGAAAAGCTGCAAAAACAGCCTTGAATAGTTTCATGCATTCCAAAGAAGCAACAGCAAGAGAAAAAGACTTATTCCGCAGCGTAAAGGACACAGATTTATCAAGAAACATTCCTGGCAAAGTGAAAGTGTCTGCACCCAATCTTCTGAACGTAAAAAGGAAATAGCTGAAATGAAATTCTAAAATATTTGAGAAGAGCCAATTTTATAGCCTTTTGGAAGTTCAAAGATGAAAGCACCATGTATCAGGATTTCCGCATTATAAAAATGAACTAAACATTGCCTTGCTATATTCACCAAAAGGACTTACTTCTTGTTTTTTCCCAGTTTTATATAGAGGAAACACTGTCTATGATAGGATTTCCAAAAGTATTTGTGGACAGTTAAATGCTAATTAATATACATCTGTAGTTATTCTACATTTTCTTGAAATTTGGGAGGTTAATACCAAGTATTCATTTCATGATGTAAAGAAACTGAACAGTGAAGTGGCTTGATTGCTTAAACTATTGACTTGGTAAGTCTACTGTATATAACATCTAATATATATAT