Transcript asmbl_19534

Sequence
Transcript Sequence for observation asmbl_19534 of TGE0004126:
GGGAGGAGTTCATACAAGTGCGCAGTGCCAGCTGCAGCAGTACGGCCCTTTGGCGTTCATCCTTGGCGACAGGACGACCAAAAAGCTGACAGAACGCAGCAGAGTGATAACCGTCGATGGCAATATATGTTCCGGGAAGAGCAAGCTTGCGAAGGTGGTAGCGGAGAAGCTAGGCTTGAGGTACTTTCCTGAAGCCGGGATCCATTATGCGGACAGCACCACGGGGGACGGAAAGCCGCTCGACGTGGAGCTCAGTGGCAACTGCAGCTTGGAGAAGTTCTACGACGACCCGAAAAGCAACGACGGCAACAGTTACCGCCTGCAGTCCTGGCTGTACGCCAGCCGCCTCCTGCAGTACGCCGACGCCTTGGAGCACCTGCTGAGCACAGGACAGGGCGTCGTGCTGGAACGCTCCATCTTCAGCGACTTCGTCTTCGTGGAGGCCATGTACAGCCAGCACTTCATCCGGAAGCAGTGTGTGAACCACTACTACGAGGTGAAGAAGGTCACCATCCGGGAGTACCTGCCCCCCCACGTGGTCATCTACGTCGACGTGCCCGTTCCAGAGCTCCAGAGCCGGATTCAGAAGAAGGGAGACCCACACGAGATGAAGATCTCCGCCGCCTACCTTCAGGCCATCGAGAATGCCTACAAGAAAACCTTCCTCCCTGAGATGAGTGAAAAATGCGAGGTCTTAGTGTATAGTGCGAATGAAGCTCAAGATGCGGAAAAGGTGGTGGAGGATATCGAATACCTCAAGTATGACAGAGGGCCGTGGCTCAACCAGGACGACCGTACCTTCCACATTCTGCGGATGCTGGTTCAGAATAAGTTGGAGGTGCTGAACTACACAACCATCCCGGTCTATCTCCCAGAAATCACGATCGGAGCTCACCAGAGTGACAGAGTCTTCCAGAAGTTCGTCGAGCTGCCAGGCCGCAGGTACAGCCCCGGGTACAACGCGGACGTGGGTGACAAGTGGATCTGGCTGAAGTGACGGCACGGCCTCCGCCAGAGCCGCTCCGTGGGACGCAGACGCCCGGCCGGCCGACCCGCACACTGTGGCTTTAGAACTGGGGGGAGTAGACGGTCCGAAATCGCAGGGTGCGGCAGCGGCACAGAGCAGGTGCCCGCAGGGTCGTCGGGGTGGGGGGACCTCGCCACCTCACTGTGGAGTAAGCACCGTTGTCGCGAGGGGAGCGCGGTCTGCGGGAGAGACGGGCGCCACCGGCACAGCCCCCCCGGCTCCCCTCGCGCTGTCGGGCACGTTTGTATGTCGCTCCCTCAGACTTGGAGAAATACAGCAGCTTCTGTGGCGCTTC