Transcript asmbl_19258

Sequence
Transcript Sequence for observation asmbl_19258 of TGE0029542:
GATTGACAACTTTACTAAAGATGTCTAAGCAACAACCAACTCAGTTTATAAATCCAGAAACTCCTGGCTATGTTGGATTTGCAAATCTTCCCAACCAAGTTCACCGAAAATCAGTGAAAAAAGGTTTCGAGTTCACACTGATGGTGGTCGGTGAATCGGGTCTAGGCAAGTCGACTCTCATCAACAGCCTGTTCCTGACCGATCTCTACCCAGAAAGAATCATACCTGGAGCTGCAGAGAAAATTGAAAGAACTGTCCAGATTGAGGCCTCGACTGTTGAGATTGAGGAGCGAGGGGTCAAGCTGCGCCTGACAGTGGTGGACACCCCTGGCTACGGTGATGCCATCAACTGCAGGGATTGTTTTAAGACGATCATCTCCTACGTCGATGAGCAGTTCGAACGGTATCTGCATGACGAGAGCGGCCTGAACCGGCGGCACATCGTCGACAACAGGGTGCATTGCTGCTTCTACTTCATCTCGCCCTTCGGACACGGACTTAAGCCCTTAGACGTTGCGTTTATGAAGGCGATACACAACAAGGTCAACATCGTGCCTGTCATCGCAAAAGCCGACACACTCACTCTGAAGGAGCGCGAGCGCCTGAAGAAGAGGATTCTGGATGAAATCGAAGAACATAACATCAAGATCTATCACTTGCCTGATGCAGAATCGGATGAAGACGAAGATTTTAAAGAGCAGACTAGGCTCCTCAAGGCCAGCATCCCGTTCTCTGTGGTCGGATCCAATCAGCTGATTGAAGCCAAAGGCAAGAAGGTCAGAGGTCGCCTCTACCCGTGGGGCGTCGTGGAGGTGGAGAACCCGGAGCACAATGACTTTCTGAAGCTGAGGACGATGCTCATCACCCACATGCAGGACCTCCAGGAGGTGACCCAGGATCTGCACTACGAGAACTTCCGCTCCGAGAGGCTCAAAAGAGGCGGCAGGTTATTGCTCGAGTCATGCTGTCCCCCTCTGTGCATAGTGTGTCACCCCAGGTTATGCCGTCCCTCTCCTGGATGGGTTTAGCTTGGTCTTCTTGACCTCTAAGCAACATGATTTGGTTTCTTGTTATGACACTAGTTTTTGTGGTATTTTAGCCTGCTCTTTAGTGTGAGTGATTAAAGGTAGTCTTTAATCATCTGCACATAAAGAACAGCTTCAGATGGGAGGGCCGGGCACTAGCTTTGAGTCTGTGAGGGAGGCACTAGCTTTGAGTCTATGAGGGAGGGTGTTAAACCGCAGCGCCCTCATCAGGGGAGGGCAGCAGGCCCCCCTCCCCACCTCCGAAACTCACGTGGCCGCCCCGTCTTGGCTTTTCTTTTTCACAGTCCTAATAGGTTTTTG