Transcript asmbl_19219

Sequence
Transcript Sequence for observation asmbl_19219 of TGE0004108:
GGGACAGTTTGGGGATCTGGCTAGCGGGAAGGTGTGGCGGCGGGACCATCCGGGAAGATGCCCGTGGCCGTGATGGCAGACAGTGCCTTTAGTTTCAAAAAGCTGCTGGATCAGTGCGAGAACCAGGAGCTCGAGGCTCCTGGAGGAATTGCTACACCTCCAGTGTATGGTCAGCTTCTAGCTTTATATCTGCTCCATAATGACATGAATAATGCAAGATATCTTTGGAAAAGAATACCACCTGCTATAAAATCTGCAAATTCCGAACTTGGAGGGATTTGGTCAGTAGGACAGCGGATCTGGCAGAGAGATTTCCCTGGGATCTACACGACCATCGGCGCTCACCAGTGGTCTGAGACGGTCCAGCCAATCATGGACGCGCTTAGAGACGCAACGCGGAGACGCGCCTTCACCCTGGTCTCGCAGGCGTACACCTCCATCGTCGCCGAGGACTTCGCCGCCTTCGTTGGGCTCCCTGTGGAGGAGGCCGTGAAAGGCATATTAGAACAAGGATGGCAAGCCGACTCTACCACAAGAATGGTCACGCCCAAAAAGCCAGTCGCAGGCGCCCTGGATGTCCCCTTTCACGGGTTCGCTCCTTTATCAGAGCCAGCCCCGGTCCCGCCCATCCCCAACGAGCAGCAGCTCGCCAGACTCACCGACTACGTGGCTTTCCTCGAAAACTGACCGGTCCCGCCTCCCGGACCCACCCCGGAGCGCTGTGTCCTGAACTGATCCAGAAATGCTAAATTTTTATTTTCAGCTTATTGGATGGATTCAGCGCCTCAGCCTTCCTTCCTGAGTGTGCGATGGTAAAACACACATATACTGTAAAGCGCATCATGTGTATTTTGTCCTTAAGCGCCCCGCTGACTAGTTGAAGCAGGCCCGGTTTCATCACGCCACAGTGCGGGTGGGCCCGCCGGTGTCACGCAGCCCGTGTGTGTCCCAGCGGCTCGTGACTGAGCTCCCCTGCGTCCTGTAGCCAGGTGCCCGTCACCTGTGTTTCCCGGTCACGCACAGCACACCGTTCCTGCTGCTGGCCGTAGGGGCGCGCCCGGGGAGGAAGGCTGTGCCCGGCGGGACCTGCACTGTGGGGCGCTCCCATCCGCCCCCTCGGGAGAATGCGCACTCTGCTCCTCGCCCCGGAGTTGCCACTGCAGAGACGCAGCCGGGGACCCGAATGGTCTCAGGAGACCAGGCTGTTTTCCCTGGCTTCGCTGATGGTGTGAGCGCGCCCGTGGCCGCAGTGGAGGGCTTGCCGTGGAAGTGAGCCTCATTAAGACGTTCGCGAGATGCGTCACGCTGTCACACGGCCCTTCAGGAGAGGGGAGCCCTGCACAGGGATGCGTCATCCTGGGACAGAAGCCGTGAAGATGACGAGCAACTTTGTCCAGCTGCCCTGCAGCTCCCGGTTGCTCACGTTTGACCCTCGGTTCAAGCTCTGCCTTTTGGAGAAATGCGGAACGAGCCCCTCCTTTTCCCGTGTGACGCCCTCTGAGTGTTTGAAGCTGTTTATTGTGTCTTCAGGTTAAAACATCCCTGCATTCATTCATTCTGCATTTGTTCAATAAATATTTAATTGAATTCTTCAACTGTTTCATCTGAG