Transcript asmbl_19156

Sequence
Transcript Sequence for observation asmbl_19156 of TGE0029535:
CCGGTTAGCGGTGGAGAAGAGGTGTTTCAGGCCCAATGGCGACTGTGGAAGCAAGCGGCAGCGATGGGAAAGGGCAAGGGGTGGAGACCCCCGTCACCTATTACCGTTTGGAGGAGGTGGCGAAGCGCAACTCCTCGAAGGACATATGGCTGGTGATCCACGGGCGAGTCTACGATATCACCCGCTTCCTTAACGAGCATCCTGGCGGAGAAGAGGTTCTGTTGGAACAAGCTGGTGCAGATGCAAGTGAAAGCTTCGAAGACGTAGGCCACTCCTCTGATGCCAGAGA