Transcript asmbl_19126

Sequence
Transcript Sequence for observation asmbl_19126 of TGE0004096:
CCGGAAGTGGAGGCGGTTGGTGAAGTTGGAGGGGCTCAGGGACGCGGTGCGGGCCGCGGTTTGTGGGCTGCGGGTGGTGACCAGCATCCTGCTGTCTGGCCCCGGTGCGGCTGTACTCGGCTGGATAGTGCGCAGCGGCAGCGACACGAACCCGGCGCGGACAGGGCGCCCGTGGCTGGGCCCATGGCCTCCTGCGCGAGCATCGACATCGAGGACGCCACGCAGCACCTACGGGACATCCTCAAGCTGGACCGGCCCACGGGGGGCCCCAGTTCAGAGAGCCAACGGCCATCTAACGCCTACAATGGGGACCTCAATGGACTCCTGGTCCCAGACCCCCTCTGCTCAGGTGATGGTACTTCAGCAAACAAGCCTGGTCTCCGGGCCATGCCACCTATTAACCTGCAGGAGAAGCAGGTCATCTGCCTTTCAGGAGATGACAGCTCTACCTGCATTGGGATTTTGGCCAAGGAGGTGGAGATTGTGGCCAGCAGTGACTCTAGCATCTCGAGCAAGGCACGAGGGAGCAACAAGGTGAAAATCCAGCCTGTTGCCAAGTATGACTGGGAGCAGAAATACTACTACGGCAACCTGATTGCTGTGTCCAACTCCTTCTTGGCCTATGCCATTCGGGCTGCCAACAATGGCTCAGCGATGGTGCGGGTGATCAGCGTCAGCACTTCGGAACGGACCTTACTCAAGGGCTTCACAGGCAGTGTGGCTGACCTGACCTTTGCACACCTCAACTCTTCACAGCTGGCCTGCCTGGATGAGGCAGGCAACCTGTTTGTGTGGCGCTTGGCTCTGGTTAATGGCAAAATTCAAGAAGAGATTTTGGTTCATATCCGGCAGCCAGAGGGTACACCACTGAACCACTTTCGTAGAATCATCTGGTGCCCCTTCATCCCTGAGGAGAGTGAGGATTGCTGTGAGGAGGGCAGCCCAACGGTGGCCCTGTTGCATGAAGACCGGGCTGAGGTGTGGGACCTAGACATGCTCCGCTCCAACCACAGCACCTGGCCTGTGGATGTCAGCCAAATCAAGCAGGGCTTCATTGTGGTGAAAGGCCATAGCACATACCTGAGTGAAGGGGCCCTCTCACCTGATGGGACTGTCCTGGCCACTGCAAGCCATGATGGCTTCATCAAATTCTGGCAGATCTACATTGAGGGGCAGGATGAGCCAAGGTGTCTGCACGAGTGGAAGCCTCATGATGGGCGGCCCCTTTCCTGCCTCCTATTCTGTGACAACCACAAGAAACAGGACCCTGATGTCCCTTTCTGGAGGTTCCTCATTACTGGCGCTGACCAGAATCGGGAGCTGAAGATGTGGTGCACAGTGTCCTGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTGTTCCCCCTAGCCTCAAAGTTTGCCTGGACCTCTCAGCAGAATACCTGATTCTCAGTGATGTGCAACGGAAGGTCCTCTACGTGATGGAGCTGCTGCAGAACCAGGAGGAGGGCCGTGCCTGCTTCAGCTCCATCTCTGAGTTCCTGCTTACCCACCCTGTCCTGAGCTTTGGTATCCAGGTCGTGAGTCGCTGCCGACTGCGGCACACTGAGGTGCTGCCTGCCGAGGAAGAGAACGACAGCCTAGGGGCTGATGGGACCCACGGAGCTGGTGCCATGGAGTCTGCAGCTGGTGTGCTCATCAAGCTCTTCTGTGTGCATACTAAGGCTTTGCAAGATGTGCAGATCCGCTTTCAGCCACAGCTAAACCCTGATGTGGTGGCCCCGCTCCCTACCCACACTGCCCATGAGGACTTTGCATTTGGAGATTCTCAGCCTGAACTGAGCTCCGGGGGGCTGGGATCAGCTGCTCATGGCTCCCAGCCTGACCTCCGACGCATTGTGGAGCTGCCTGCACCTGCTGACTTCCTTAGTCTGAGCACTGAGACCAAGCCCAAGCTGATGACACCTGATGCTTTCATGACATCTAGCACCTCCCTGCAGCAGATCTCTGCATCCCCTAGTAATAGCAGCGGCGGCAGCAGCAGTGGTAGCAGCAGCAGCAGCAGCAGCTCCTCTCTTACAGCTGTGTCTGCCATGAGCAGTACCTCGGCTGTGGACACCTCCTTGTCCAGGCCCCCTGAGGAGCTGACCTTGAGCCCCAAGCTGCAGCTGGATGGCAGTTTGACAATGAGCAGCAGTAGCAGCCTGCAGGCAAGCCCACGCAGCCTCCTGCCCGGCCTGTTACCAGGTCCAGCTGACAAATTGACTCCCAAAGGGCCTGGGCAGGTGCCTACTGCTGCCTCTGGACTGTCCCTGGAGCTGCAGGAAGTGGAGCCCCTGGGGCTACCCCAGGCTTCCCCTAGCCGTACTCGCTCCCCTGATGTTATTTCCTCAGCTTCCACTGCCCTGTCCCAGGATATCCCTGAGATCGCGTCTGAGGCCCTGTCCCGTGGCTTTGGCTCCTCTGCTCCTGAGGGCCTTGAACCGGACAGTATGGCCTCAGCTGCTTCAGCACTACACTTGCTGTCCCCACGGCCACGGCCCGAGCTTGGGCCCCAGCTTAGCCTGGATGGAGGCCCTGGGGATGGGGATCGGCATAGTACCCCTTCCCTCCTGGAGGCAGCCTTGACCCAAGAGGCTACAGCCTCTGACAGTCAGGTCTGGCCAACAGCACCAGACATTACTCGGGAGACCTGCAGCAGCCTGGCAGAAAGCCCTAGGAATGGCCTTCAGGAAAAGCACAAGAGCTTGGCCTTCCACCGACCGCCTTATCATCTGCTGCAGCAACATGACAGCCAGGATGCCAGTGCTGAACAAAGTGACCATGATGATGAGGTGGCCAGCATTGCCTCTGCTGCAGCGGGCTTTGGCACCAAAGTTTCCACTCCACGGCTTCCTGCCAAGGACTGGAAGACCAAGGGATCTCCTCGGGCCTCACCTAAGCTCAAGAGGAAGGGCAAAAAGGATGATGGGGATTCGACTGCGGGATCCCGGCTCATGGAGCACCAGGTGAGTTGAGAAAACACTCTTTATACTTCTAGGACTCTTTCTTGAGAGTGGGGAAGGGTTCTGGGCCATTCCCTGGTCTGGCGTGTGGTACGGGTGGGGCAGGCATTATGTGACTGTTGGCACTACTGGCAGGTGACAGAGCCCCCTGAGGATTGGCCTGCAATAATTTGGCAACAGCAGAGAGAGCTGGCAGAGCTGCGGCACAGCCAAAAAGAGCTACTGCAGCGTCTGTGCACCCAGCTCGAAGGCCTGCAGAGTACCGTCACAGGCCATGTAGAACGTGCCCTCGAGTCCCGGCATGAACAGGAGCAGCGGCGGTTGGAGCGGGCACTGGCAGAAGGGCAGCAGCGGGGTGGGCAGCTACAAGAGCAGCTGACGCAACAGCTGTCACAGGCACTGTCTTCAGCTGTGGCTGGGAGGCTGGAACGCAGCATACGGGATGAGATCAAGAAGACAGTGCCTCCATGTGTCTCTAGGAGTCTGGAACCCGTGGCAGGCCAACTGAGCAACTCAGTGGCCACCAAACTCACAGCTGTGGAGGGTAGCATGAAAGAGAATATCTCCAAGCTGCTGAAGTCCAAGAACTTAACAGACGCTATTGCCCGAGCAGCTGCAGACACGTTACAAGGGCCAATGCAGGCTGCCTACCGTGAAGCCTTCCAGAGTGTGGTGCTGCCTGCCTTCGAGAAGAGCTGCCAGGCCATGTTCCAACAGATCAATGATAGCTTCCGACTGGGCACACAGGAATACTTGCAGCAGCTAGAGAGCCACATGAAGAGCCGGAAGGCACGAGAACAGGAGGCGCGGGAGCCTGTGTTGGCCCAGCTGCGGAGCCTGGTCAGCACACTGCAGGGTGCCACTGAGCAGATGGCAGCCACTGTGTCTAACAGTGTTCGGGCTGAGGTGCAACACCAGCTGCATGTGGCTGTGGGCAGCCTGCAGGAGTCAATTTTAGCACAGGTACAGCGCATTGTTAAGGGTGAGGTGAGTGTGGCACTCAAGGAGCAGCAGGCCTCCGTCACCTCTAGCATCATGCAAGCCATGCGCTCAGCTGCAGGCACACCTGTCCCAGCTGCCCACCTCGACTGCCAGGCCCAGCAAGCCCATATCCTGCAGCTGCTGCAGCAGGGCCACCTCAATCAGGCCTTCCAGCAGGCCCTCACGGCTGCTGACCTGAACCTGGTGCTGTATGTGTGTGAAACTGTGGACCCAGGCCAGGTTTTTGGGCAGCCACCCTGCCCACTCTCCCAGCCCGTGCTCCTTTCCTTCATCCAGCAGCTGGCCTCTGACCTTGGCACTCGAACTGACCTCAAGCTCAGCTACCTGGAAGAGGCTGTGATGCACCTGGACCACAGTGACCCCATCACTCGGGACCACATGGGTTCCGTCATGGCCCAGGTGCGCCAGAAGTTATTCCAGTTCCTGCAGGCTGAGCCATACAACTCACTTGGCAAAGCGGCCCGGCGTCTTAGCCTCATGTTGCATGGCCTTGTGACCCCCACCCTCCCTTAGCAAAGCCTGCCTTGCCCAGGGGTGCAGTGGCATTGAAGACCAGCAGACAGGCCTAGACCAAAGCAGGGTCATGTCTGCCCTTTATCTGCTCAGGCTCCCACCTCTGGGGTAGTTGAGAGGGGGAACACTGGCTGTAGTCTACAGGTTATGGTAGCCAGCAGGTTTAGGCTGAGCCCAGGGTGGGTATTGTGCCTTCTTGGGTTCTGCCATGCCTGGAGCATGACCCCCTGAGATTGTGATACCACTTGAGTTGAATTTTCCATGTTCCTTTTTACCTCTGTTTTGGATCTTTCTGTTTTTGAAAAACATTGAGAAATTCA