Transcript asmbl_18157

Sequence
Transcript Sequence for observation asmbl_18157 of TGE0004045:
GAGGTGTTTATGAGGCGCTGGGGGCGGAGGGGGAGAATTAGTCCGAGTGGAGCGAGCGAGCTGAGTGGTTGTGTGGTCACGTCTCGGAGACCCGTAGCTCTTGCAGCATGGAAAAGCGAGTAACTTCTATGTGCTAAAGATATCACAAACCTCAGGCTCACTTTGAGATTTCAAGAGTCAAGAGAAAATGACTGGTTGGACTTATCATTTGGCTGACCAACTGACTGAAGAGCAAATTGCAGAATTCAAAGAAGCTTTTTCACTATTTGACAAGGATGGTGATGGAACTATAACAACAAAGGAATTGGGAACTGTAATGAGATCTCTTGGGCAGAATCCCACAGAAGCAGAGTTACAGGACATGATTAATGAAGTGGATGCTGATGGTAACGGCACAATTGACTTCCCAGAATTTCTGACAATGATGGCAAGAAAAATGAAAGACACAGACAGTGAAGAAGAAATTAGAGAAGCATTCCGTGTGTTTGACAAGGATGGCAATGGATATATTAGTGCAGCAGAGCTTCGCCATGTGATGACAAACCTTGGAGAGAAGTTAACAGATGAAGAGGTTGATGAGATGATCAGGGAAGCAGATATTGATGGTGATGGTCAAGTAAACTATGAAGAGTTTGTACAAATGATGACAGCAAAGTGAAGACATTGTACAGAATGTGTTAAATTTCTTGTACAAAATTGTTTATTTGCCTTTTGTTTGTAACTTATCTGTAAAAGGTTTCCCCCTACTGTCAAAAAAAATATGCATGTATAGTAATTAGGACTTCATTCCTCCATGTTTTCTTCCCTTAATTGTCATTGTCCTGAAACCTTATTTTAGAAAATTGATCAAGTAACATGTTGCATGTGGCTTACTCTGGATATATCTAAGCCCTTCTGCACATCTAAACTTAGAAGGAGTTGGTCAAATGAGGGAACATCATCTGGGTTATGCCTTTTTTTTAAGTAGTTTTCTTTAGGAACTGTCAGCATGTTGTTGTGAAGTGTGGAGTTGTAACTCTGCGTGGACTATGGACAGTCGACAATATGTACTTAAAAGTTGCACTATTGCAAAACGGGTGTATTATCCAGGTACTCGTACACTATTTTTTTGTACTACTGGTCCTGTACCAGAAACATTTTCTTTTATTGTTACTTGCTTTTTAAACTTTGTTTAGCCACTTAAAGAAAATCTGCTTATGGCACAATTTGCCTCAAATCCATTCCAAGTTGTATATTTGTTTTCCAATAAAAAAAAATTTTACCCAATTTTACCCAACTGTTGCTCTGAATCTGAGTCATTTAATTAACTTGAGGTCAAATAATTTTGAGAATCAGATGTGGAG