Transcript asmbl_17595

Sequence
Transcript Sequence for observation asmbl_17595 of TGE0003993:
AAGAGATTTCGTTTTTCTCTTACGCACTCTCGTGCGTCTCACCTGCGTAGTTTTTGCCCGGCGGGAACGCGCAGCGGGGGAAGTTTGTCTCGGTGAAGGGAAGCTTAACGCTGAGACCCCGGAGCGGCGGCAGCCATGGCGGATGTGACCGCCCGTAGCCTGCAGTACGAGTACAAGGCGAACTCGAATCTTGTCCTCCAAGCTGACCGCTCTCTCATTGACCGTACCCGCCGGGATGAGCCCACGGGAGAGGTGCTGTCCCTGGTTGGGAAGCTGGAGGGCACCCGGATGGGAGATAAGGCTCAACGGACCAAACCGCAGATGCAGGAGGAAAGAAGAGCCAAGCGAAGGAAGCGTGACGAGGACCGGCACGACATCAACAAGATGAAGGGGTACACGCTGCTCTCAGAGGGTATCGACGAGATGGTGGGCATCATTTACAAGCCCAAAACCAAAGAGACCCGGGAGACCTACGAGGTGCTGCTTAGCTTCATCCAGGCTGCCCTTGGGGACCAGCCACGTGATATTCTGTGTGGGGCAGCTGATGAAGTTCTAGCTGTCCTAAAGAATGAAAAGCTTCGTGATAAAGAAAGGAGAAAGGAGATCGACTTGCTGTTGGGTCAGACAGATGATACCAGATACCATGTTCTAGTGAACTTGGGCAAAAAGATCACAGACTACGGTGGAGACAAGGAAATCCAGAACATGGATGACAACATTGATGAAACATATGGCGTGAATGTACAGTTTGAGTCTGATGAGGAGGAAGGTGACGAAGATGTGTATGGGGAGGTTCGAGAAGAGGCCTCCGATGACGACATGGAAGGGGACGAGGCAGTGGTGCGCTGCACCCTTTCGGCTAATCTTGTTGCATCTGGGGAACTGATGAGTTCCAAGAAGAAGGATTTGCACCCTCGGGACATTGATGCCTTCTGGCTGCAGCGGCAGCTCAGTCGCTTCTATGATGATGCCATCGTGTCGCAGAAGAAGGCAGACGAAGTGTTGGAGATCTTGAAGACAGCGAGCGATGATCGGGAGTGTGAGAACCAGTTGGTGCTGCTGCTCGGCTTCAACACTTTCGATTTTATTAAAGTGCTGCGGCAGCACAGGATGATGATTTTGTACTGTACCTTGCTGGCCAGTGCTCAGAGTGAAGCTGAAAAGGAAAGGATCATGGGAAAGATGGAGGCCGACCCAGAGCTCTCGAAGTTCCTCTACCAGCTCCACGAGACGGAGAAGGAGGATCTGATCCGGGAGGAGCGGTCCCGGAGGGAGCGAGTGCGGCAGTCCCGAATGGACACTGACCTGGAAACCATGGACCTGGACCAGGGTGGGGAGGCACTGGCCCCGCGGCAGGTTCTCGACTTGGAAGACTTGGTCTTTACCCAGGGGAGCCACTTCATGGCTAATAAACGCTGTCAGCTTCCAGATGGATCCTTCCGTCGCCAGCGCAAGGGCTACGAAGAGGTGCATGTACCTGCTCTGAAGCCCAAGCCTTTTGGCTCAGAGGAGCAACTGCTTCCAGTGGAGAAGCTGCCCAAGTATGCCCAGGCTGGCTTTGAGGGCTTCAAAACACTGAACCGGATCCAGAGTAAGCTGTACCGGGCCGCCCTGGAGACAGATGAGAACCTGCTGCTGTGTGCCCCCACTGGCGCCGGCAAGACCAACGTGGCTCTGATGTGCATGCTCCGAGAGATAGGGAAGCACATCAACATGGATGGCACCATCAATGTGGATGACTTCAAGATCATCTACATCGCTCCCATGCGGTCTTTGGTGCAGGAGATGGTGGGCAGCTTTGGAAAGCGCCTGGCTACCTACGGCATCACTGTCGCCGAGCTGACGGGTGACCACCAGCTGTGCAAGGAGGAGATCAGTGCCACTCAGATCATTGTCTGCACCCCCGAGAAGTGGGACATCATCACCCGCAAAGGCGGCGAGCGCACATACACCCAGCTTGTGCGGCTCATCATCCTGGATGAGATCCATCTCCTTCATGATGACAGAGGTCCTGTCTTAGAGGCGTTGGTGGCCAGGGCCATCCGAAACATTGAAATGACCCAAGAGGATGTCAGGCTCATCGGGCTTAGCGCCACCCTCCCCAACTATGAGGACGTGGCTACCTTTCTACGCGTTGACCCTGCCAAGGGCCTTTTCTACTTTGACAACAGCTTCCGCCCAGTGCCTCTGGAACAGACCTACGTGGGTATCACAGAGAAAAAAGCCATCAAGCGTTTCCAGATCATGAATGAGATAGTCTATGAGAAGATCATGGAACATGCTGGAAAAAATCAGGTACTGGTGTTTGTCCATTCCCGGAAGGAGACGGGGAAGACGGCCAGGGCTATCCGGGACATGTGCCTTGAGAAGGACACACTGGGCCTATTTCTCCGAGAGGGCTCTGCCTCCACCGAGGTCCTGCGGACGGAAGCCGAGCAGTGCAAGAACCTGGAGCTGAAGGACCTTCTGCCCTATGGCTTTGCCATTCACCATGCGGGCATGACCAGGGTGGACAGGACACTTGTGGAGGATCTCTTTGCTGACAGGCACATTCAGGTTTTAGTCTCCACAGCAACTCTGGCTTGGGGTGTGAACCTCCCTGCACACACAGTTATCATCAAAGGCACCCAGGTGTACAGTCCGGAGAAGGGGCGCTGGACGGAACTGGGGGCTCTGGATATTCTGCAGATGCTGGGACGTGCTGGAAGACCCCAGTACGACACCAAGGGTGAAGGCATACTCATCACGTCTCACGGGGAGCTCCAGTACTACCTGTCCCTCCTCAACCAGCAGCTTCCTATTGAGAGCCAGATGGTGTCAAAGCTGCCCGACATGCTCAACGCGGAGGTGGTACTGGGCAATGTCCAAAACGCGAAGGATGCGGTGAACTGGTTGGGCTATGCCTACTTGTACATACGCATGCTGCGGTCCCCAACCCTCTACGGCATCTCTCACGACGATCTCAAGGGAGACCCCTTGCTGGACCAGCGCCGACTGGACCTGGTTCACACTGCCGCCTTGATGCTAGATAAGAACAACCTGGTCAAGTATGACAAGAAGACGGGAAACTTCCAGGTGACAGAACTGGGTCGTATAGCCAGCCACTACTACATCACCAATGACACGGTGCAGACCTACAATCAGCTGCTGAAGCCCACCCTGAGTGAGATCGAGCTTTTCAGGGTCTTCTCGCTGTCCTCGGAGTTTAAGAACATCACCGTGAGAGAGGAGGAGAAACTGGAGCTGCAGAAGCTGTTGGAGCGGGTGCCCATCCCTGTGAAGGAGAGCATTGAGGAACCCAGTGCGAAGATCAATGTGCTTCTCCAAGCCTTCATCTCACAGCTGAAATTGGAGGGCTTTGCACTGATGGCTGACATGGTATATGTGACACAGTCAGCGGGCCGGTTGATGCGGGCCATCTTTGAAATTGTTCTGAACCGAGGTTGGGCGCAGCTGACAGACAAGACCCTGAACCTCTGCAAGATGATTGACAAACGCATGTGGCAGTCCATGTGTCCTCTGCGTCAGTTCCGGAAACTCCCTGAGGAGGTAGTGAAGAAGATTGAGAAAAAGAACTTCCCTTTTGAGCGTCTGTACGACCTGAACCACAATGAGATAGGGGAGCTCATCCGCATGCCCAAGATGGGCAAGACAATCCACAAGTACGTCCACCTGTTCCCCAAGTTGGAGCTGTCTGTGCATCTGCAGCCCATCACGCGCTCCACCTTAAAGGTGGAGCTGACCATCACGCCGGACTTCCAGTGGGATGAAAAGGTCCATGGTTCATCAGAGGCCTTTTGGATTCTGGTGGAGGATGTGGACAGCGAAGTGATACTGCACCATGAGTACTTTCTGCTCAAGGCCAAGTACGCCCAGGACGAGCACCTTATCACGTTCTTCGTGCCTGTTTTTGAACCGCTGCCCCCTCAATACTTCATCCGTGTGGTGTCTGACCGCTGGCTCTCTTGCGAGACCCAGCTGCCTGTCTCCTTCCGACACCTGATCCTGCCGGAGAAGTACCCGCCTCCCACCGAGCTGCTGGACCTGCAGCCCTTGCCCGTGTCCGCCCTGAGAAACAGTGCCTTCGAGAGCCTTTACCAAGACAAATTCCCCTTTTTCAATCCCATCCAGACACAAGTGTTCAACACCGTGTACAACAGCGACGACAATGTGTTTGTGGGGGCCCCCACCGGCAGTGGGAAGACCATCTGTGCGGAGTTCGCCATCCTGCGGATGTTGCTGCAGAACTCGGAGGGGCGCTGCGTCTATATCACCCCCATGGAGGCACTGGCCGAGCAGGTGTACATGGACTGGCACGAGAAGTTCCAGGACAGGCTCAGCAAGAAGGTGGTGCTCCTGACGGGCGAGACCAGCACGGACCTGAAGCTGCTGGGCAAGGGCAGCATTGTCATCGGTACCCCCGAGAGGTGGGACATCCTCTCTCGGCGCTGGAAGCAGCGCAAGAACGTCCAGAACATCAGCCTGTTCGTGGTGGACGAGGCCCACCTCATCGGGGGCGAGAACGGGCCTGTCTTGGAAGTGATCTGCTCCCGGATGCGCTACATCTCCTCCCAGATTGAGCGGCCCATTCGTGTTGTGGCGCTTAGCTCCTCGCTCTCAAATGCTAAGGACGTGGCCCACTGGCTAGGCTGCAGTGCCACCTCCACGTTCAACTTCCACCCGAACGTGCGCCCCGTGCCTTTGGAGCTGCACATCCAGGGCTTCAACATCAGTCACACGCAGACTCGCCTATTGTCCATGGCCAAGCCAGTGTACCATGCCATCACCAAGCACTCTCCCAAGAAGCCTGTCATCGTTTTTGTGCCTTCTCGTAAGCAGACCCGCCTTACGGCAATTGACATCCTCACCACGTGTGCGGCGGACATCCAACGACAGAGGTTCTTACACTGCACCGAGAAGGATCTGATCCCGTACCTGGAAAAGCTGAGTGACAGCACGCTCAAGGAGACGCTGTTAAACGGCGTGGGCTACTTGCATGAGGGTCTCAGCCCCCTGGAGCGGCGTCTGGTGGGACAGCTCTTCAGCTCAGGGGCCATCCAGGTAGTTGTTGCTTCTCGGAGTCTCTGCTGGGGCCTGAGTGTGACCGCCCACCTGGTGATCATCATGGACACCCAGTACTACAATGGCAAGATCCACGCGTATGTGGACTACCCCATCTATGATGTGCTTCAGATGGTGGGGCACGCCAACCGCCCTCTGCAGGATGACGAGGGGCGTTGTGTCATCATGTGCCAGGGCTCCAAAAAGGATTTCTTTAAGAAGTTCTTATATGAGCCATTGCCAGTGGAGTCTCACCTGGACCACTGTATGCATGACCACTTCAATGCCGAGATTGTCACCAAGACCATTGAGAACAAGCAGGACGCTGTAGACTACCTTACCTGGACCTTTCTGTACCGCCGCATGACGCAGAACCCCAACTACTACAACTTGCAGGGCATCTCCCATCGTCACCTGTCTGACCACTTGTCAGAGCTGGTGGAGCAGACGCTGAGTGACCTGGAGCAGTCCAAGTGCATCAGCATAGAGGACGAGATGGACGTGGCTCCTCTAAACCTGGGCATGATCGCCGCCTACTACTACATCAACTACACCACTATCGAGCTCTTCAGCATGTCCCTGAATGCCAAGACCAAGGTGCGTGGGCTAATCGAGATCATCTCCAACGCAGCCGAGTACGAAAACATCCCGATCCGGCACCACGAGGACAACCTGCTGCGGCAGTTGGCTCAGAAGGTCCCCCACAAGCTGAACAACCCCAAGTTCAATGACCCACATGTCAAGACCAATCTACTTCTTCAGGCTCATCTGTCTCGTATGCAGCTGAGCGCTGAGCTGCAGTCAGATACAGAGGAGATCCTTAGCAAGGCCATCCGGCTCATCCAGGCCTGTGTGGATGTCCTCTCCAGCAATGGGTGGCTCAGCCCTGCTCTGGCAGCCATGGAGCTGGCCCAGATGGTCACCCAAGCCATGTGGTCTAAGGACTCATACCTGAAACAGCTGCCTCATTTCACTTCGGAGCACATCAAACGTTGCACAGACAAGGGAGTGGAGAGTGTTTTCGACATCATGGAGATGGAGGATGAAGAACGGAACGCATTGCTTCAGCTGTCTGACAGCCAGATGGCAGACGTGGCCCGTTTCTGTAACCGCTACCCTAACATTGAGCTGTCTTACGAAGTTGTGGATAAGGACGGCATCCGCAGTGGCGGGCCCGTTGTGGTGCTGGTGCAGTTGGAGCGAGAGGAGGAAGTCACAGGCCCCGTGATTGCGCCTCTCTTCCCACAGAAACGTGAGGAGGGCTGGTGGGTGGTGATTGGAGACGCCAAGTCCAACAGCCTTATCTCCATCAAGAGGCTGACCCTGCAGCAGAAGGCCAAGGTGAAGCTTGACTTTGTGGCCCCAGCCACTGGCGCCCACAACTACACTCTATATTTCATGAGCGATGCTTACATGGGATGTGACCAAGAATACAAGTTCAGTGTAGATGTGAAAGAAGCCGAGACAGACAGCGACTCGGATTGAGTGTGGAGGCCTGTGCTCTTGCCTGGAGGGGTTGGACCTGAACAAAGAGCATGTCTGGGTCACAGTTGTGGACAGTAAGTCTGCTGGCATGAGGGCGGACTGCCAGGCAGTGCAGGTGCACCCCAGGGCCCCTCCACATTTCCTCTTGCCACCTTGGCATCCAAGCTTTGGATCCGGTGTCTGTAGGTGTCGTGTAGCTGTCGTGTTAACTGGATAGCATTTTTAGGCATGTTCTTTGTTTTATTAGGTGTTTTAATAAAATCAGTTGGAGAAATCA