Transcript asmbl_17578

Sequence
Transcript Sequence for observation asmbl_17578 of TGE0003990:
CACGGCCCCGCGTTTGGAGCCGCCGCGGTCCAGTCCTTCTGCCTGCCCGCCTGTTCGCTAGTCCCTCCTGCCGCCCGCCTGCTGGGCAGGGCCGGCCCGGCCCGGCCCGGCCATGGAGTCCTACGATATCATCGCCAACCAGCCCGTGGTCATCGACAACGGTTCGGGAGTGATCAAGGCTGGCTTTGCAGGAGACCAGATTCCCAAATACTGTTTCCCAAACTATGTCGGGCGCCCTAAGCACATGCGGGTGATGGCTGGAGCCTTGGAAGGGGACCTCTTCATGGGACCAAAAGCAGAGGAGCACCGGGGGCTTCTGGCCCTGCGCCACCCCATGGAGCACGGCGTTGTGCGGGACTGGAATGACATGGAGCGCATCTGGCAGTATGTCTACTCCAAGGACCAGCTGCAGACCTTCTCCGAGGAGCATCCTGTCCTTCTAACGGAAGCCCCGCTCAACCCAAGTAAGAACCGGGAGAAGGCGGCAGAGGTGTTTTTTGAGACCTTCAACGTGCCAGCCCTGTTTATCTCCATGCAGGCCGTGCTCAGCCTGTACGCAACAGGACGCACAACAGGAGTGGTCTTAGATTCAGGGGACGGGGTCACCCATGCTGTTCCCATCTACGAGGGCTTTGCCATGCCGCATTCCATCATGCGGGTGGACATTGCCGGCCGCGACGTCTCCCGCTATCTCCGGCTGCTGCTGCGCAAGGAAGGCGTTGACTTTCACACCTCAGCTGAGTTTGAGGTTGTCCGAACCATCAAAGAGCGGGCCTGCTACCTGTCCATCAACCCACAGAAGGATGAGGCTCTGGAGACAGAGAAGGTGCAGTATACTTTGCCGGATGGCAGCATACTCGACGTGGGGCCAGCACGATTCCGGGCCCCTGAGCTGCTGTTCCAGCCGGACCTGGTGGGGGACGAGAGTGAGGGGCTCCATGAGGTGCTGGCTTTTGCCATCCACAAGTCCGACCTGGACCTCCGCCGGACACTGTTCGCCAACATTGTGCTTTCAGGCGGCTCCACGCTGTTCAAAGGCTTTGGGGACCGATTACTAAGTGAAGTGAAGAAGCTTGCACCAAAGGATGTCAAAATCAAGATCTCGGCCCCCCAGGAACGGCTGTACTCCACATGGATCGGTGGCTCCATCCTGGCCTCACTGGACACTTTCAAGAAGATGTGGGTCTCCAAGAAGGAGTACGAGGAGGATGGCGCCCGTGCTATTCATCGTAAAACCTTCTAGCGCCCAAGGAGAAAGGCAGTGTGCTGGGCGAGTGGGAAGAAAGGGGCCAGAGCCCCAACCCTGTCTGGTCTGGGCCCACATACACCAGGCCCAGGGTTCCCTGTGTGCCCTGAACCCCGGGAAGGCGGTACAGCATCTTCCCTGCAGCCCTCCCCTTTGCACACACACGCACACACAGTAACGTTTAGCTGCATGGGTGGGGGTCTTGAGCTGGAACATAGAAATTGATGTGCCCAGCCATAGGTGGTTCTGGGTGTCCCTTTGGCAGGGCCAGTTAGGGCTACGGTTCCTGGCTCTGATCCTTGGGGCTGCTTCTTCCCCAGGCTCCAAGGCTTGACCCCCGAATGCCCCCGTTTCCTCTGACAGGGTCCCTCCCAGGACGAGGGCACCCGGGTGCCTGTGTAATTAGCCTTGGGGAGTGGGATAGAGGAGAAGGTGTCCAGCAGCTCCCCACTGGTGCATCCTTGCTTCTCGTGCCATCTCATCTTCCTGACCCGACAGAGTAGCACAGAGGGCCAGCCACTCCTGGCATAACTGGCCTCCCACACTGTCCCCCTCATCTTCCTGAGTGGATGTCTTTGTGTAGGCTGAGTACTGAGCAGTCTGCTGTCCCCAGTGAGGGGGTCTGACATAGGGTTGCACCCCCTGGAGCCAGGGCAGCAGATGCTTGGGGTTTGGACAGCCAGTCTGTTGCGCTGTCCCTTTCACAGTGCTTCACTGCCTTGCTTCTCCCCTGTCCTTTACCCTGGGCAAGCGTTAGTGGTCTTCCCTTGTTGAGAGTCAGACCCAGAGGGGTGAGGGGAAAGATCTCCTGTCCCACCTCACCCACTGGGAGGGTCATTACCCTGGGCCAGGGCCCCTCCCCGTCCCAGGTATGTACAATAATTTAACACAGTTGCCTGAAGAAAACTTTTTTGTAAATCATTATAGTAATAATTATCAACAAGG