Transcript asmbl_17402

Sequence
Transcript Sequence for observation asmbl_17402 of TGE0000435:
GGCAGAGGCGGCGCCAGCCATGTTGGCCGGGCGGAGGTCTTCGCTGAGGCCCGGGGCGGGGTGGCGCCACCCCTGATTGCGGTGCCACGGACTGCTCCTGCTGGGCGGAGAGGACAGATTTTGCAAAGCGGAGGCTGCGACGGGTCCTGCAGGGGGACAGTGAGGAAAGGGCCGCCTCGTCTCCGCTCCTGGGGGACCGCAGAAATAAGAATCAAACTCCACAATGACAACCTATTTGGAATTCATTCAACAAAATGAAGAACGAGATGGAGTCCGATTTAGTTGGAATGTTTGGCCATCAAGTCGACTGGAAGCTACAAGAATGGTTGTTCCTGTGGCAGCCCTGTTTACACCACTGAAAGAGAGACCTGACTTACCACCTATTCAATATGAACCTGTTCTGTGTAGTAGGACCACTTGCCGTGCAGTTTTGAATCCTTTATGTCAAGTGGATTATCGAGCAAAACTTTGGGCTTGCAACTTTTGTTACCAAAGGAATCAGTTTCCACCTAGTTATGCTGGTATATCTGAACTGAATCAGCCTGCTGAACTTTTACCTCAGTTTTCTAGCATTGAATATGTAGTTCTGCGTGGTCCTCAGATGCCTTTGATATTCCTCTATGTGGTTGATACTTGCATGGAAGATGAAGATTTACAAGCCCTGAAAGAATCCATGCAGATGTCATTAAGTCTTTTACCACCTACAGCTTTGGTTGGACTTATTACTTTTGGGAGAATGGTTCAGGTTCATGAACTTGGATGTGAAGGCATTTCAAAAAGCTATGTCTTCAGAGGAACAAAAGATTTGTCTGCCAAACAACTGCAGGAAATGCTGGGGCTCTCTAAAGTACCACTTACTCAAGCAACACGTGGTCCTCAGGTACAGCAGCCACCTCCTTCCAACAGATTCTTACAACCAGTACAGAAAATAGACATGAATCTCACAGATCTTCTGGGAGAACTCCAGCGAGACCCTTGGCCTGTACCACAGGGAAAGAGACCTTTGCGTTCCTCTGGGGTGGCACTTTCCATAGCTGTAGGACTGCTGGAGTGTACTTTTCCCAACACTGGTGCTCGTATCATGATGTTCATTGGTGGTCCTGCTACTCAGGGGCCTGGAATGGTGGTTGGAGATGAGTTGAAGACACCTATAAGATCGTGGCATGACATTGACAAAGACAATGCCAAATATGTTAAAAAGGGAACTAAGCATTTTGAAGCATTGGCTAATCGAGCTGCTACAACTGGCCATGTTATTGATATCTATGCGTGTGCATTAGATCAGACAGGTCTCCTGGAGATGAAATGCTGTCCCAACCTTACTGGAGGATACATGGTAATGGGTGATTCTTTCAATACTTCCTTATTCAAACAAACTTTTCAAAGAGTCTTTACCAAAGACATGCATGGACAGTTTAAAATGGGCTTTGGTGGTACGCTAGAAATAAAGACCTCAAGGGAAATAAAGATTTCAGGAGCTATTGGACCCTGTGTGTCACTCAATTCTAAAGGACCCTGTGTGTCTGAAAATGAGATAGGAACAGGTGGCACATGTCAGTGGAAGATATGTGGACTTAGTCCCACTACAACCTTAGCCATATATTTTGAGGTTGTCAATCAGCATAATGCTCCAATTCCTCAAGGAGGGCGTGGTGCAATCCAGTTTGTGACTCAGTATCAGCATTCAAGTGGGCAGAGACGCATCCGAGTGACCACCATTGCTAGGAACTGGGCAGATGCTCAAACTCAAATCCAAAACATTGCTGCATCTTTTGACCAGGAGGCAGCTGCCATTCTTATGGCCCGGCTAGCAATATATAGAGCAGAAACAGAAGAAGGTCCAGATGTGCTTAGGTGGCTGGACAGACAGCTCATTCGACTGTGTCAGAAATTTGGAGAATATCATAAAGATGACCCAAGTTCCTTCAGATTTTCAGAAACTTTCTCCCTTTATCCACAGTTTATGTTTCATTTAAGAAGATCTTCTTTCCTGCAAGTTTTTAACAATAGTCCTGATGAGAGTTCATATTATCGTCACCATTTTATGCGTCAAGATCTGACCCAGTCTCTAATTATGATTCAGCCTATCCTGTATGCGTATTCTTTTAGTGGACCACCAGAGCCGGTTCTTCTTGATAGCAGTAGCATTCTTGCAGATCGTATTCTTCTCATGGACACATTCTTCCAGATTTTGATTTATCATGGTGAGACCATAGCACAGTGGCGGAAGTCAGGATACCAGGATATGCCTGAGTATGAAAATTTCCGCCACCTTCTGCAAGCCCCAGTGGATGATGCACAGGAAATTCTTCACTCCAGATTTCCAATGCCAAGATACATTGACACTGAACATGGAGGCAGCCAGGCCCGTTTCCTCCTTTCAAAAGTCAACCCTTCACAGACTCATAATAATATGTATGCCTGGGGGCAGGAGTCTGGAGCACCTATTCTTACAGATGATGTTAGTTTACAAGTGTTTATGGATCACTTGAAGAAACTTGCTGTGTCCAGTGCTGCTTGAAGTGCTAATAATGTTAAAGACACTTAAGAAGATGAAATAATATTCAAATTTCATTTTTTCCTTTTTCCATTTATCTGTGGAAACCAACAGATATTGCTCTATATTTTTTGTATTAGTATGGTTTGAGACAACATATGGAAAATGTTCACATTTGTAGATTAAGCTGGAATTATAATGAGAGCAATAAGAACAAATTTATTTTGCTTACCACAGTGTTATAGCTGGTTCTAGAAATTTGAAGTCTTTATAACTTAATTATGTTTAATAAAAAATAGAGTCTGCCTCGTACTACAGATGTAACTCATTTGTATATTGCAGACAGACCCAAAGTGGCACTGAATTTTCTTGCTCACCTTTTAAAAACTTGTTCCTTAATTTTAGCCAGAAAGCAAAAAAACAATAGTAATGATAAATGTGAACATTTTTGCTTATTCATTGAATATTTTTCTG