Transcript asmbl_16772

Sequence
Transcript Sequence for observation asmbl_16772 of TGE0003931:
CGGGCCGCCCGGGTTCAGTCGCCACGTGAGTGCTCCTACCCTACCTGCGACACACTCCGCGGGCAGCATGTCGGCGACAGCGGTGGCTCGAAAGCGGGGAAAGCCGGCCTCGGGGGCCCGGGCTGGTGCGGGGGCCGGCAAGCGGCGGCGAAAGGCCGACTCTGCCGGGGACAGAGGCAAGTCCAAAGGTGGCGGCAAGATGAATGAGGAGATCTCCAGCGATTCCGAGAGTGAGAGCCTAGCTCCCAGGAACATGGAGGAGGAGGAGGAGCTGGAGGAGACCGCACAGGAGAAGAAGCTGCGCTTAGCCAAGCTCTACTTGGAGCAGCTGAGGCAGCAAGAGGAGGAGAAAGTGGACGCCCGTGAGTTTGAGGAGGACCAGGTGGCGGGGCGCCTGAAGGAGGACGTGCTGGAGCAGAGGGGCAGGCTGCAGAAGTCAGTAGCAAAGGAGATCCAGGCCCCAGCCCCAGCTGACATTCGCATCTTACGGGGCCACCAGCTCTCCATCACGTGTCTGGTTATCACCCCTGACGACTTGGCCATCTTTTCTGCCGCCAAAGATTGCACCATCATTAAGTGGAGTGTGGAGAGTGGACGGAAGCTTCACGTGATCCCACGAGCCAAGAAAGGGACCGAGGGGCAGCCCCCCGGCCACAGCAGCCACGTCCTCTGCATGGCCATCTCCTCCGACGGCAAGTACCTTGCCTCGGGCGACCGCAGCAAGCTCATCCTGATTTGGGAGGCCCAGAGCTGCCAGCACCTGTACACCTTCACGGGGCACCGGGACGCCGTGTCGGGGCTGGCATTCCGCAGAGGCACCCACCAGCTCTATAGCACGTCCCACGACCGTTCCGTGAAGGTGTGGAACGTGGCAGAGAACGCCTACGTGGAGACCCTCTTCGGGCACCAGGACGCCGTGGCTGCATTGGATGCCCTGAGCCGGGAGTGCTGCGTGACGGCTGGGGGCCGGGATGGGACCGTGCGTGTGTGGAAGATCCCCGAGGAGTCGCAGCTTGTCTTCTACGGCCACCAGGGCTCCATCGACAGCATCCAGCTCATCAACGAGGAGCACATGGTGTCAGGCGCAGACGATGGCTCTGTGGCTTTGTGGGGCCTCTCCAAAAAACGGCCACTTGCTCTGCAGCGTGAAGCCCACGGGCTGCGGGGGGAGCCGGGCCTGGAGCAGCCCTTCTGGGTGTCGTCGGTGGCAGCCCTGCTCAACACAGACCTCGTGGCCACAGGCTCCCACAGCTCTTGTCTGCGGCTCTGGCAGTGCGGGGAGGGCTTCCGGCGGCTTGACCTTCTCTGCGACATCCCCCTGGTGGGCTTTATCAATAGCCTCAAGTTCTCCAGCGCTGGGGACTTCCTCGTGGCTGGGGTGGGGCAGGAGCACAGGCTGGGCCGCTGGTGGCGAATCAGAGAGGCTCGGAACTCTGTCTGCATCATCCCGCTTCGGAGGGGTCCCAGGCCCACGGCCGCGGGCTCTTAACCTTCTCATCCCCTTTATTTAAGTCCTTCCCAAGCCGCGTCCTTCCCTTTTTGTATTAAAAGCCT