Transcript asmbl_16189

Sequence
Transcript Sequence for observation asmbl_16189 of TGE0029421:
GTTCTCGCGACTTTTGCTTTACCCTTCTCTTGTGTTACTGCTGTCGCGAGACTTCCTACTCCTCCGCCTCCTCCGCCGCTCCCTTTGCTGCCGCTTTAGCCTGGGACCCGGACCCAGCCTCTCCCCCACTCGAACGTCGGCCCCGGCTCTGCCGAGGTCCCGGTCCCCCAACCCCGCCTCGCCGCCGCCATGGCGGACCCTAAATACGCTGACCTTCCCGGCATTGCCAGGAACGAGCCAGATGTTTATGAAACCAGCGACCTACCTGAGGATGACCAAGCGGAGTTTGATGCGGAGGAGCTGACAAGCACAAGTGTGGAACACATCATTGTCAATCCCAATGCTGCCTATGACAAGTTCAAAGACAAGAGAGTGGGGACAAAGGGACTTGATTTCTCAGATCGAATTGGAAAAACCAAGAGGACAGGATATGAATCTGGAGAATATGAGATGCTTGGAGAGGGTCTGGGAGTGAAAGAGACACCCCAGCAAAAGTATCAGCGACTCCTGCATGAGGTCCAAGAGCTGACAAGTGAAGTCGAGAAAATCAAGACAGCAGTGAAGGAGTCAGCCACTGAGGAGAAGCTGACCCCCGTGGTGCTGGCTAAACAGCTGGCAGCCCTGAAGCAGCAGCTGCTTGCTTCCCACCTGGAGAAGCTACTGGGACCAGATGCAGCGATCAACCTTACTGACCCTGATGGAGCTCTGGCTAAGCGTCTGCTGCTGCAGCTGGAAGCAACAAAGAACAGCAAAGGGGCTGGTTCAGGGGGAAAGACCACAAGTGGGACCTTCCCAGATGGCAGCCTAGTCACTTATGAACTGCATTCTCGGCCTGAGCAGGACAAGTTCTCTCAAGCTGCCAAAGTTGCAGAACTTGAGAGGCGCCTGACAGAGCTGGAAGCAACTGTACGCTGTGATCAAGATGCCCAGAATCCCCTCTCTGCAGGTCTACAGGGAGCCTGCCTTACGGTGAGTATGAAAGGAACAGTAGTGTTTGGATTACAGAAGGAATATTGGTATTGGGCTGCTTGGAGAATTG