Transcript asmbl_16187

Sequence
Transcript Sequence for observation asmbl_16187 of TGE0014907:
GTTCTCGCGACTTTTGCTTTACCCTTCTCTTGTGTTACTGCTGTCGCGAGACTTCCTACTCCTCCGCCTCCTCCGCCGCTCCCTTTGCTGCCGCTTTAGCCTGGGACCCGGACCCAGCCTCTCCCCCACTCGAACGTCGGCCCCGGCTCTGCCGAGGTCCCGGTCCCCCAACCCCGCCTCGCCGCCGCCATGGCGGACCCTAAATACGCTGACCTTCCCGGCATTGCCAGGAACGAGCCAGATGTTTATGAAACCAGCGACCTACCTGAGGATGACCAAGCGGAGTTTGATGCGGAGGAGCTGACAAGCACAAGTGTGGAACACATCATTGTCAATCCCAATGCTGCCTATGACAAGTTCAAAGACAAGAGAGTGGGGACAAAGGGACTTGATTTCTCAGATCGAATTGGAAAAACCAAGAGGACAGGATATGAATCTGGAGAATATGAGATGCTTGGAGAGGGTCTGGGAGTGAAAGAGACACCCCAGCAAAAGTATCAGCGACTCCTGCATGAGGTCCAAGAGCTGACAAGTGAAGTCGAGAAAATCAAGACAGCAGTGAAGGAGTCAGCCACTGAGGAGAAGCTGACCCCCGTGGTGCTGGCTAAACAGCTGGCAGCCCTGAAGCAGCAGCTGCTTGCTTCCCACCTGGAGAAGCTACTGGGACCAGATGCAGCGATCAACCTTACTGACCCTGATGGAGCTCTGGCTAAGCGTCTGCTGCTGCAGCTGGAAGCAACAAAGAACAGCAAAGGGGCTGGTTCAGGGGGAAAGACCACAAGTGGGACCTTCCCAGATGGCAGCCTAGTCACTTATGAACTGCATTCTCGGCCTGAGCAGGACAAGTTCTCTCAAGCTGCCAAAGTTGCAGAACTTGAGAGGCGCCTGACAGAGCTGGAAGCAACTGTACGCTGTGATCAAGATGCCCAGGTCAGGTGCTCTCCTGTACTTAGTCTGACCCTCACATCCTGCACCATAAGCCTGAGGTCCACAGCATTCCACAGAATTCTGGGAACAGTCGGGAAAGGGCTTCAGTTACAGGATCAACCAGTGGGCTGCCAACTAGAACATAAAGAATAGGAGAACGTGGTGATCACATAGAGGAAACTGTAGAGCTGTTGCAGGCAAAAGTGAGCTCCCTGGACCTTGCAGTTTTGGACCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGATGAATGAGATTGCCAAGCATAAAGCTTCTGTAGAGGATGCAGATACACAGAGCAAGGTGCACCAGCTATATGAAACCATACAGCGTTGGAGCCCCATCGCCTCCACCCTTCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTACATGAGCAAGCCATGCAGTTCAGTCAGCTCCTGACACACTTGGATACCACACAGCAGATGATAACTAGTTCCCTCAAGGACAATACCACCCTCTTGTCCCAGGTACAGACAACCATGCGTGAAAACCTGTCCACAGTTGAGGGGAATTTTGCCAACATTGATGAACGGATGAAGAAGCTGGGAAAGTGAGCCCCTTTGGAAGATGGAGAACAGGGGTAATGCCTACCCCTTTGAACTCTGTTAACAGCTTACATAGGGTTTCCCCTTAAATATAACTCGCGTATCCCCATCCCATTTGACACTAGGGACAAGGGTTCTTGCATGTGGGGTTTACATCCCTCCTCTGATGACTAGTGTGGTAGCTGGGGGATATTAGATGGTGGTGTCTCCTTGGGCCCCAGGGATGAGGACATGGGCTCAGCCACATGCCAGCTCACGTCTAATACTGCTTTGTCCAGTGTGGGGAAAGATTGGGTCCTGTCCTCCAGCACAGCTTCTGTGGCTGATTGTAACACTGTACAACTGTTTCTGAC