Transcript asmbl_16062

Sequence
Transcript Sequence for observation asmbl_16062 of TGE0029409:
AGTGAAATTCTTCCTGGAAGAGGTAGATGTAATATATACTGTCTTCCCCTCTTTCTCTCAGAAACAGTACATGAAGTGGCCCTGAAGGACAAGGAGCCAGACACACAGGATGCAGACGAAATGAAGAAGGCCCTGGAGCTACAGATGGAGAGTCACCGGGAGGCCCACCACCGGCAGCTGGCCCGGCTCCGGGATGAGATCAACGAGAAGCAGAAGACCATCGATGAACTCAAAGACCTGAATCAGAAGCTCCAGTTAGAGCTAGAGAAGCTTCAGGCTGACTATGAGAAGCTGAAGAATGAAGAACATGAGAAGAGCACCAAACTCCAGGAGCTGACATTTCTGTACGAGCGACATGAGCAGTCCAAGCAGGACCTCAAGGGTCTGGAGGAGACAGTTGCCCGGGAACTCCAGACCCTCCACAACCTTCGCAAGCTGTTCGTTCAAGACGTCACGACTCGAGTCAAGAAAAGTGCAGAAATGGAGCCCGAGGACAGTGGGGGGATTCACTCCCAAAAGCAGAAGATTTCCTTTCTTGAGAACAACCTGGAACAGCTTACAAAGGTTCACAAACAGCTGGTACGTGACAATGCAGATCTGCGTTGTGAGCTTCCTAAATTGGAAAAACGACTTAGGGCTACGGCTGAGAGAGTTAAGGCCCTGGAGGGTGCACTGAAGGAAGCCAAGGAGGGCGCCATGAAGGACAAGCGCCGGTACCAGCAGGAGGTGGACCGCATCAAGGAGGCTGTTCGGTACAAGAGCTCTGGCAAGAGGGGCCATTCTGCTCAGATTGCCAAACCCGTCCGACCTGGCCACTACCCAGCATCTTCACCCACCAACCCCTATGGTACCCGAAGCCCTGAGTGCATCAGTTATACCAACAGCCTCTTCCAGAACTACCAGAATCTGTACCTGCAGCCTGCACCTAGCACCACCTCAGATATGTACTTTGCAAACTCCTGTACCGGCAGTGGGACCATGTCTTCTGGCAGCCCCTTGGCTTCCTACCAGAAGGCCAACATGGACAATGGAAACGCTACAGATATCAATGACAATAGGAGTGATCTGCCATGCGGCTATGAGGCTGAGGACCAGGCCAAGCTTTTCCCTCTCCACCAAGAGACTGCGGCCAGCTAATCTCCCACTGGACTGCTGCATACCTGCACTTTCAGGTAGCTTCAGGCCGATTCCTCTGACCAGCCTCAGGTTGCCTCCTTTCTTGCCCTCAGCCTATTTATTTCTCCCACTTTTATTTATCATCTCAAACCTTTTACTACTTAGCTGTCCCCCAACTCCTGTTTTCTCCGTCCTAGG