Transcript asmbl_10890

Sequence
Transcript Sequence for observation asmbl_10890 of TGE0000043:
AGGAAGGCGCCGGTTTCGGCGGGGGCTGCACGTGCGCAGGGGTGTGGAAACTTACCGGCTGAGCCATGGATACACCGTTAAGGCGCAGCCGACGGCTGGGAGGCCTAAGGCCCGAATCCCCCGAGAGCCTCACCTCAGTTTCGCGGACGAGACGGGCCCTTGTGGAGTTCGAGTCGAACCCAGAAGAAACGAGGGAGCCCGGGTCTCCTCCGAGTGTGCAGCGGGCTGGCCTGGGGTCCCCCGAAAGGCCGCCGAAGACAAGCCCAGGATCACCCCGTCTGCAGCAGGGTGCAGGCTTGGAGTCACCCCAAGGGCAGCCAGAGCCAGGCGCAGCGTCCCCCCAGCGTCAGCAAGACCTACACCTGGAGTCGCCTCAAAGACAGCCAGAGTACAGTCCTGAATCCCCACGATGTCAGCCGAAGCCAAGTGAGGAGGCACCAAAGTGTTCTCAGGACCAGGGAGTACTGGCCTCGGAGTTGGCCCAGAATAAGGAGGAGCTGACCCCGGGGGCCCCCCAGCATCAGCTACCGCCGGTCCCAGGATCACCAGAGCCTTACCCCGGTCAGCAAGCTCCCGGTCCGGAGCCCTCTCAGCCACTACTGGAGCTGACACCCAGGGCACCTGGCTCCCCCCGGGGTCAGCATGAGCCGAGCAAGCCACCTCCAGCTGGGGAGACGGTGACAGGCGGCTTCGGGGCAAAGAAGCGAAAAGGTTCTTCATCCCAGGCCCCAGCGTCCAAGAAGTTGAATAAAGAGGAGCTTCCTGTAATCCCGAAGGGGAAGCCCAAATCGGGGCGAGTGTGGAAGGACCGCTCCAAGAAAAGATTCTCCCAGATGCTTCAGGACAAGCCCCTGCGCACATCGTGGCAGCGGAAGATGAAGGAACGACAGGAGAGGAAGCTGGCCAAGGACTTTGCCCGTCACCTGGAGGAGGAGAAGGAGAGGCGCCGCCAGGAGAAGAAACAGCGCCGGGCTGAGAACCTGAAACGCCGCCTGGAGAATGAGCGGAAGGCAGAGGTCGTCCAAGTGATCCGAAACCCCGCCAAGCTCAAGCGGGCAAAGAAGAAGCAGCTGCGCTCCATTGAGAAGCGGGACACCCTGGCCCTGCTGCAGAAGCAGCCGCCCCAGCAGCCGGCAGCCAAGATCTGAGCTCAGGACGGCCCGAGGCCTTCCATGGCCAACAACCATGTCAGACACAGCACCTCAGGCCGCTGCTCAGATGCCTCTGCTGGAGCTGGCACTCCAAACCCATGGCTCCAGAACAGGGACCCCCACCCCGACCGGGGCTCCTCGGCCTTTGAAGGCTTCCAGGCAGGTCTGTGTGGGACAGAAGCCCAGAGGGGGCCTGGGACCTGGCAGAGATGGGGGCGGGAAGAGATTCAGCTCCCATCCCTCCTTCCTCTCCTTCTCCAAGTGCCTTCAAACCAAGAACTGTACATTCTTCTGGTTCCTCAGTGAGCTGGTGACTGGCAGGTGACTCCCTCAGCAGTGTATGCCCTTTCTCAGCATCCTAGGTCCATCCCAGGCCTGGAGGCTGACAGTTGGGAATCCAGCTTCCCCCACACCTTCCCAAAGGCTGCTCTGAGCACCTCCACACCCCACTGCCTCTGTCCCCAGCAGACTGAATCCGGTTCCTCTCCACTTTTCAATACTGAAAGATTAAAATGGGGAGGTTGCAGGGAGCAGAGCTTTTCCCTAGCACCCACTTTCCCAAACCAGTCTCTGCAGAAGCCCCAGAGAATCTAACTCATGCCTGTCCAGTCTACAGCAAAAATATTTATTGAGTGCCTGTTGCATACAGGCACAATCCTAGGCACCGGCAAATACAGACAATAGACCAAAGTCCCTGCCCTCGAGGAGCTTTCATTCTGATGGAGAGAAAACATAATAAACAAGCAAAATGCACC