Transcript asmbl_14677

Sequence
Transcript Sequence for observation asmbl_14677 of TGE0003804:
GCCGCAGTAAGGACGGTCAGTTGCGTTGCCGCTTTCAGGCATCCGTTTAGGACAGCCCCATGGGGCCTGAAGGGGCTTCGTATGGCAACCGGTACAGTTGAGAGTTCAACGGCGCGTTGCAAAGATGCCGCCCAAAGGAAAAAGCGGTTCTGGAAAAGGGGGAAAAGGGGGAGCAGCTTCTGGGAGTGACACTTCTGACAAGAAGTCTCAGGGTCCCAAAGGTGGTGGCAATGCAGTAAAGGTCAGACACATTCTGTGCGAAAAACACGGGAAAATCATGGAAGCCATGGAAAAGCTGAAGTCTGGAATGAGATTCAATGAAGTGGCCGCACAGTACAGTGAAGATAAAGCCAGGCAGGGGGGCGACCTGGGCTGGATGACCAGAGGGTCCATGGTGGGGCCATTTCAAGAAGCAGCATTTGCCTTGCCTGTAAGTGGGCTGGACAAGCCTGTGTTTACAGACCCTCCGGTTAAGACAAAATTTGGATATCATATTATTATGGTTGAAGGGAGAAAATAAAACTATCGCAAGACCGAA