Transcript asmbl_22301

Sequence
Transcript Sequence for observation asmbl_22301 of TGE0004259:
GAAGAAATCATAGCCTATAAGCCACCAGGATTTAGTCTGATGTATCATCTTCTGAATGAGTCACCAATGTTGGAGCTTGCTCTTAGCTTACTGGAAGAAGGCGTTAAGCAGCTGGATACTTATGCCCCTTTCCCTGGGAAGAAGCATTTGGAGAAAGCGGTACAGCACTGCCTTGCCCTTCTCAATCTTACTCTGCAAAAGGAAAACCTCTTTATGGATCTTCTAAGAGAGAGTCAACTGGCTCTGATAGTCTCTCCTTTAGAACAGCTTCTGCAGGGCATCAATCCCAGAACTAAGAAGGCTGATAATGTGGTGAATATTGCCAGATACCTGTATCATGGCAATACTAATCCAGAATTGGCTTTCGAAAGTGCCAAGATCCTCTGCTGTATCTCTTGCAACACCAATATTCAGATAAAATTGGTTGGAGATTTCACACATGACCAGAGTGCTTTGAATTAAAGAAACCTGTCAGTACCACAAACCTACAAGATCCAGGAGTGTTAGGCTGCCCTCGAACGTGCCTTCACGCCATCTTAAACATCTTGGAGAAAGGAACGGAAGGGAGGACAGGCCCGGTGGCAGTGAGAGAATCGCCTCAACTCGCTGAGCTGTGTTACCAGGTGATATATCAGTTATGTGCATGCTCCGATACATCTGGCCCTACTATGAGGTACTTGAGAACCAGCCAGGATTTCTTATTTTCTCAATTGCAACATTTACCTTTTTCTAATAAAGAATATGAAATATCTATGTTGAACCAAATGTCATGGCTGATGAAGACTGCTTCGATAGAACTAAGGGTAACCTCTCTGAATCGTCAGCGGTCACATACCCAGCGGCTCCTGCACCTCTTGTTGGATGACATGCCAGTGAAACCATACTCAGATGGTGAAGGAGGAGTAGAAGATGAAAATAGGTCTGTCTCTGGATTCCTTCACTTTGACACTGCCACAAAAGTGCGTCGAAAAATTCTGAGTATTCTTGACTCAATTGACTTTAGTCAGGAGATACCCGAGCCTTTGCAGTTGGATTTCTTTGATCGGACTCAGATTGAACAAGTTATTGCTAACTGTGAACATAAGAATTTACGGGGACAGACAGTCTGCAATGTCAAGCTTCTTCATAGGGTTCTTGTAGCCGAAGTTAATGCCCTTCAGGGTATGGCAGCCATAGGACAGAGACCTCTACTGATGGAGGAAATCAGCACTATACTTCAGTATGTGGTAGGAAGAAACAAATTGTTGCAGTGTCTTCATGCAAAACGGCACGCGCTGGAGTCATGGCGGCAGCTGGTAGAAATTATACTGACAGCTTGTCCCCAGGACCTCATTCAGGCAGAGGACCGACAACTGATTATTCGTGATATTTTACAAGATGTGCATGATAAGATCCTGGATGATGAAGCAGCACACGAGTTAATGCCGGTGGTAGCAGGTGCTGTGTTCACCCTGACTGCTCACTTGAGCCAGGCCGTTCGCACAGAACAGAAGCATCCATTAGCCTTGAGGCCTGGAGAGGCCCATTACGCTTTTACGCTCGATGGTTGTTTCACCTCACCTCCTCCAGCAGAGAACCCAGTGGTGGGTTTTGCTTCTATTGGAGATTCTTCACTTCACATCATATTGAAGAAACTGTTAGACTTCATTTTGAAGACAGGTGGCGGATTCCAGCGAGTGAGGACACACCTGTATGGCTCTCTGCTTTATTATTTACAGATCGCCCAGAGACCAGATGAACCGGACACCTTAGAAGCAGCCAAGAAAACCATGTGGGAAAGATTGACAGCTCCTGAAGACGTGTTTAGTAAATTGCAGCGAGAAAACGTAGCCATCATCGAGAGCTATGGTGCCGCCCTCATGGAGGTGGTTTGTCGGGACGCTTGTGACGGCCATGAGATCGGAAGGATGCTGGCGCTGGCTCTGCTTGATCGGATCGTCTCTGTAGACAGGCAGCAGCAGTGGCTTCTGTACCTCTCCAACAGTGGCTATTTGAAGGTGCTTGTGGACAGCTTGGTAGAAGATGACCTTACGTTGCAGAGCTTACTCACCCCACAACCTCCGCTTTTAAAAGCCCTTTATACCTATGAATCCAAAATGGCATTTCTCACGAGAGTAGCTAAGATACAGCAGGGTGCCTTAGAGCTGCTGAGATCTGGGGTGATCGTGAGACTGGCACAATGCCAAGTCTATGACATGCGCCCAGAAGTGGACCCGCAGGGCGTGTTTGGCATGAGAGACCCCCCAGTGTTCATCCCTACTCCGGTGGACCGGTACCGCCAGATTCTCCTTCCGGCTCTCCGCTTGTGCCAGGTCATCCTCACGTCTAGTATGGCCCAACACTTGCAGGCAGCAGGGCAGGTGTTGCAGTTTCTCATTTCGCATTCTGATACCATACAAGCAATCCTGCGCTGCCAGGATGTTAGTGCTGGGTCTTTGCTGGAGTTGGCTCTGCTCACAGGAATTATAAGTAAAGCAGCACTTCCTGGTATATTAAGTGAACTTGATGTGGATGTAAATGAAGGATCTCTAATGGAGCTACAGGGACATATTGGAAGGTTCCAGCGCCAGTGCTTAGGACTACTAAGTCGCTTTGGTGGCTCGGACAGACTCCGTCAGTTTAAATTTCAAGATGATAATGTGGAAGGAGATAGAGTGAGCAAGAAAGACGAGATTGAACTGGCTATGCAACAGATTTGTGCCAATGTCATGGAATATTGCCAGTCGCTCATGTTACAGAGTTCCCCTACCTTTCTGCATGCCGTGTGTCTCTTCACCCCAAGCCTGTCAGAAACCGTTAACAGAGATGGGCCCCGGCAAGATACCCAAGCTCCAGTAGTTCCGTATTGGCGCCTGCCTGGTTTGGGCATTATTGTCTACCTGCTGAAACAGAGCGCTAGTGATTTCTTCAGCTATTATGACAGTCACCGACGGAGTGTCAACAAGCTACAGAATGTAGAGCAGCTTCCACCAGATGAGATAAAAGAGTTATGTCAGTCTGTGATGCCTGCTGGTGTTGATAAAATCTCCACCACCCAGAAATATGTTCTAGCAAGACGGCGTTTGGTGAAGCTGATCAACAATCGAGCCAAACTGCTTTCCCTTTGTTCTTTCATCATAGAGACCTGCCTCTTTATCCTCTGGCGCCATCTGGAGTACTACCTGTTACATTGCACGCCCACAGATTCGCAAGATTCCTTGTTCGCCTCCAGGACCTTGTTTAAAAGCAGAAGGCTACAAGATTCCTTAGCTTCAGAAGCCAATCTAGATTTTAGAAGTGGACTGACTATAGTGAGCCAACATGACATAGACCAGCTCCAGGCCGACGCTATCAACGCCTTCGGAGAATCACTGCAAAAGAAACTTCTGGACATTGAAGGATTATATTCAAAAGTTCGATCTCGCTATAGTTTCATACAAGCTCTTGTCAGACGTATCCGAGGCTTACTGAGGATATCACGGAACTGAGCTCTTCTAGGGAAGAGATGAATTGGAAAACTGTCTCCTTTTTATAGATTAGTTTGTCTTTAAATTATGACCAAAAAATATTTTGCTATTTCTTTCTTTATATATGGACATCTTTTCTGTAAACTTCTTTGCCTGGTTTCATCCTCATTAGTAAAAAAA