Transcript asmbl_17362

Sequence
Transcript Sequence for observation asmbl_17362 of TGE0000433:
CTTTGGCCTGGGACTCTGCCCCTCTACCTCAGCACAGAATCGCCCCGGGTCCTACTACAGAATCAATCCTTGAACACTGCCTCCACGTCGCCGGCTCAATCTGGGCGAGAACCCAGACTTCCACCGCAGCCCCGCAATCTGCAGACCTCAGCGGCAGCGCAGGTGGCAGACCTGCCTCCTTTGCCTGTGAGTCATGGCAGCTCCCATGAATGGCCAAGTGTGTGTGGTGACTGGTGCCTCCAGGGGTATTGGCCGTGGCATTGCCTTGCAGCTCTGCAAAGCAGGCGCCACAGTTTACATCACTGGCCGCCATCTGGACACCCTTCGCGTTGTTGCTCAGGAGGCACAATCCCTCGGGGGCCAATGTGTGCCTGTGGTGTGCGATTCAAGCCAGGAGAGTGAAGTGCGAAGCCTGTTTGAGCAAGTGGATCGGGAACAGCAAGGGCGTCTAGATGTGCTGGTCAACAATGCTTATGCAGGGGTCCAGACGATCCTGAACACCAGGAATAAGGCATTCTGGGAAACCCCTGCCTCCATGTGGGATGATATCAACAACGTCGGACTCAGAGGCCACTACTTTTGCTCAGTGTATGGGGCACGGCTGATGGTACCAGCTGGCCAGGGGCTCATCGTGGTCATCTCCTCCCCAGGAAGCCTGCAGTATATGTTCAATGTCCCCTATGGTGTGGGCAAAGCTGCGTGTGACAAGCTGGCTGCTGACTGTGCCCACGAGCTGCGGCGCCATGGGGTCAGCTGTGTGTCTCTGTGGCCGGGGATTGTGCAGACAGAACTGCTGAAGGAGCATATGGCAAAGGAGGAGGTCCTGCAGGATCCTGTGTTGAAGCAGTTCAAATCAGCCTTCTCATCTGCGGAAACCACAGAATTGAGTGGCAAATGTGTGGTGGCTTTGGCAACAGATCCCAATATCCTGAGCCTGAGTGGTAAGGTGCTGCCATCCTGTGACCTTGCTCGACGCTATGGCCTTCGGGATGTGGACGGCCGCCCCGTCCAAGACTATTTGTCTTTGAGCTCTGTTCTCTCACACGTGTCCGGCCTGGGCTGGCTGGCCTCCTACCTGCCCTCCTTCCTCCGTGTGCCCAAGTGGATTATTGCCCTCTACACTAGCAAGTTCTAACCCTCCTGGTCTGACACTACGTCTCTGCTTGTCTTCTCA