Transcript asmbl_14072

Sequence
Transcript Sequence for observation asmbl_14072 of TGE0029351:
CGGCGGCAGACGCGGTGCTCGGTCATGGGGTTCCAGCCGAGCCCAGGCCTCCTGGCCTCCCTGGGGGTGGGGCTGCTGACTCTGCTCGGCCTGGCTCTGGGCTCCTACTTGGTTCGGAGGTCCCGCCGGCCGCGGGTCACTCTTCTGGACCCCAATGAGAAGTACCTGCTGCGACTGCTGGACAAGACGACTCTGAGCCACAACACCACGAGGTTCCGCTTTGCCCTGCCCACCGCCCACCACGTTCTGGGGCTGCCTGTGGGGAGACACGTCTATCTCTCTGCCCGAATCGATGGCAGCCTGGTCATCAGGCCATACACTCCCGTCACCAGTGATGAGGACCAAGGCTACGTGGATCTCGTCGTCAAGGTGTATCTGAAGGGCGTGCACCCCAAATTTCCTGAGGGAGGGAAGATGTCTCAGTACCTGAACAGCCTGAAGATTGGGGATGTGGTGGAGTTTCGAGGCCCGAACGGGTTGCTCACTTACCTCGGGAAAGGGATTTTTAGCATTCAGCCCGACAAAAAGTCTCCAGCGGAGCCCCGTGTGGCCAAGAGCCTAGGGATGATTGCCGGTGGGACAGGTGCGTGTCGCCGGAGCCACCCTCCCGCCATTGCCGATGTTGCCATGAAAACTCGCAAGTGATCCTCGGAAGGTTTGGCAGTCATCGTCAGCAATGCCTGGGTC