Transcript asmbl_14071

Sequence
Transcript Sequence for observation asmbl_14071 of TGE0029350:
CGGCGGCAGACGCGGTGCTCGGTCATGGGGTTCCAGCCGAGCCCAGGCCTCCTGGCCTCCCTGGGGGTGGGGCTGCTGACTCTGCTCGGCCTGGCTCTGGGCTCCTACTTGGTTCGGAGGTCCCGCCGGCCGCGGGTCACTCTTCTGGACCCCAATGAGAAGTACCTGCTGCGACTGCTGGACAAGACGACTCTGAGCCACAACACCACGAGGTTCCGCTTTGCCCTGCCCACCGCCCACCACGTTCTGGGGCTGCCTGTGGGGAGACACGTCTATCTCTCTGCCCGAATCGATGGCAGCCTGGTCATCAGGCCATACACTCCCGTCACCAGTGATGAGGACCAAGGCTACGTGGATCTCGTCGTCAAGGTGTATCTGAAGGGCGTGCACCCCAAATTTCCTGAGGGAGGGAAGATGTCTCAGTACCTGAACAGCCTGAAGATTGGGGATGTGGTGGAGTTTCGAGGCCCGAACGGGTTGCTCACTTACCTCGGGAAAGGGATTTTTAGCATTCAGCCCGACAAAAAGTCTCCAGCGGAGCCCCGTGTGGCCAAGAGCCTAGGGATGATTGCCGGTGGGACAGGAATCACCCCGATGCTTCAGCTGCTCCGGGCCATCCTGAAAGACCCTGAAGACCGAACTCAGTGCTGTTTGCTTTTCGCCAACCAGGTTGGTTTGCTTTTTGCAGCGCTGGGACATCAAAGTTGAGTGGGCTGGGTTTGGAGCTGCGGTACCA