Transcript asmbl_13947

Sequence
Transcript Sequence for observation asmbl_13947 of TGE0003765:
CGCGCTGCCTTCCCAGGAGGCTGTGCGCTGCCCTTGCTGCCTTTGGGTTCTTGAGAGCGAGCGCGTGAACGGCTCTCTGCAGTCTAGTCATGGCGCTTCACGTCCCCAAGGCCCCGGGCTTTGCCCAGATGCTCAAGGAGGGAGCGAAGCATTTTTCAGGATTAGAAGAAGCAGTGTACAGGAACATACAAGCTTGCAAGGAGCTTGCCCAAACCACTCGTACAGCGTATGGACCAAATGGAATGAACAAAATGGTTATCAACCACCTGGAGAAGTTGTTTGTGACAAATGATGCAGCGACTATTTTAAGAGAGCTGGAAGTACAGCATCCTGCTGCAAAAATGATCGTAATGGCCTCTCACATGCAAGAGCAAGAGGTTGGAGATGGCACCAACTTTGTTCTGGTGTTTGCCGGAGCTCTTCTGGAATTAGCGGAAGAGCTTCTTAGAATTGGCCTGTCAGTTTCGGAGGTCATAGAAGGTTACGAAATAGCCTGCAAAAAAGCCCATGAGATTCTTCCTGATTTGGTATGCTGTTCTGCAAAAAATCTTCGAGATATTGATGAAGTGTCATCTCTACTTCATACCTCCATAATGAGTAAACAGTATGGTAATGAAGTCTTTCTGGCCAAGCTTATTGCTCAAGCATGTGTATCTATTTTTCCTGATTCTGGCCATTTCAATGTTGATAACATCAGAGTTTGTAAGATTTTGGGCTCTGGTATCTCTTCCTCTTCAGTATTACATGGCATGGTTTTTAAGAAGGAAACTGAAGGTGATGTAACATCTGTCAAAGATGCAAAAATAGCAGTGTACTCCTGTCCTTTTGATGGCATGATAACAGAAACTAAGGGAACGGTATTGATAAAGACTGCTGAAGAGTTGATGAATTTTAGTAAGGGAGAAGAAAATCTTATGGATGCACAAGTCAAAGCTATTGCTGATACCGGTGCAAATGTCGTCGTAACAGGTGGTAAAGTGGCAGACATGGCTCTTCATTATGCAAACAAATACAATATCATGTTGGTGAGGCTGAACTCAAAATGGGATCTCAGAAGGCTGTGTAAAACAGTTGGTGCTACAGCTCTTCCTAGATTGACTCCTCCTGTGGTTGAAGAAATGGGACATTGTGACAGTGTTTACCTCTCAGAAGTTGGAGACACACAGGTGGTGGTTTTCAAGCATGAAAAGGAAGATGGAGCCATTTCTACCATAGTTCTTCGAGGCTCTACAGACAATCTGATGGATGATATAGAAAGGGCAGTAGATGATGGTGTTAATACTTTCAAAGTTCTCACAAGGGATAAACGTCTTGTACCTGGAGGTGGAGCAACAGAAATTGAGTTAGCCAAACAGATCACGTCATATGGAGAGACATGTCCTGGACTAGAACAGTATGCCATTAAGAAGTTTGCTGAGGCATTTGAAGCTATTCCCCGGGCACTGGCAGAAAACTCTGGGGTTAAGGCCAATGAAGTAATCTCTAAACTTTATGCAGTACATCAAGAAGGAAATAAAAATGTTGGATTAGATATTGAGGCTGAAGTTCCTGCTGTAAAGGACATGTTGGAGGCTGGTATTCTAGATACTTACCTGGGAAAATACTGGGCTATCAAACTGGCCACCAATGCTGCTGTCACTGTACTTAGAGTGGATCAGATCATCATGGCAAAACCAGCTGGTGGACCTAAACCTCCAAGTGGGAAGAAAGACTGGGATGACGACCAAAATGATTGAATGGTTAATTTTTACTGTAGGCAAAGGCTGTAGGTATAGTAGTACTCTAGGAATTGCCTGATCTTTTCCTATTCTTAAATTAAGAGGTGTTTTGTGTTTATATCCTTGGCTGGTTGATAAAATAAATGTGTTGTTACTATCAAA