Transcript asmbl_13586

Sequence
Transcript Sequence for observation asmbl_13586 of TGE0003736:
GACACGGAACGGCTGTATTCAGTGGTGTTCCAAGAAATCTGTGGGCGCTACGGGAAGACGTACAGCTGGGACGTCAAGTCCCTCGTCATGGGCAAGAAGGCCTTCGAGGCGGCCCAGGTCATCATAGACGTGCTGCAGCTGCCGATGTCCAAAGAGGAGCTGGTGGCAGAGAGCCAGGCCAGGCTCGAAGCGCTGTTCCCCACGGCGGGCCTCCTGCCAGGGGTGGAGAAGCTGATCCACCATCTGCGAAAGCATCGCGTGCCCTTTGCCGTGGCCACCAGCTCCGGGTCCGACACCTTCGTGATGAAGACCAGCGCGCACAAAGCGTTCTTCAGCCTCTTTCATCACGTCGTGCTGGGGGACGACCCCGAAGTGAAGAACGGCAAGCCGGACCCCGACATATTCCTCGCGTGTGCGAGGAGGTTCCTCCCCCCCGCCCCCGTGGACAAGTGCCTTGTCTTTGAAGACGCTCCCAACGGGGTGGAGGCGGCCCTCGCAGCCGGGATGCAGGTGGTCATGGTGCCCGATGCACACCTGCGCCGAGACCTGACGGCCAAGGCCACCGTGGTGCTGGAGTCCCTGCAGGACTTCCGGCCCGAGCTCTTCGGGCTGCCGCCCTACGAGTGAGCGGCGGCCACGCTGCTCCGCCTGCCCCGCACCCGCGTGTCACCATCGCCACGTCGCCCTCGTCCCAGCCTCACCCCTGTGCGCTGGCTCCAAAACGATGATAGGCTGTAGCCCCACGGTCGAGAGGAAACAAGGTAGAGACAGCGGGCAGGGTGCACTGAGCACAGCTGTCCCTTGCACAGTTAGAGTTGCCTACTGTATTAGTCTTAGCATAGTCAGAGTCACACACAGTGAGCACACGTGCACACACATCCATGCTTATGTGTGAACACGCACGCAGATATGTACGCGTGTGTATACATACGTGCATAGATATGTAAAATACAAGGAAAAATGAAATTACGTTTGTGTTCATTTCTTTTTAGTTTTTCTAAACCCTGACTAGAACATGTAAAAAATGCACACATATATTTATATGCTTTAGTCCGTGTGTGTGTGTGTACGTATACATATTTATAATTTATGTTCATTGTAAATATTTACAGTGTACATAAACACTGCAGAAATTGATACTCTTTTTTGCCTTCGAAATACCTCTCGACCATATCACCGGTGGTATTTTTAGTATGAACATAATTTTAGCCTGTATCTCATACCTAGGCACATACCCACATTCAAAAATGGTTTATAGCTCAAAAATTTATCCTCTCTCCTCTGAGAACATTTATTTTTCTAATATGTGCCTTGATGTATATGTAATTTGATTTCCGAATGTGTACTTGGTACAGCCCAGAGCCACAGCACATTTCCAGGATAATTCATCAGATGTTACACTTTGGCCATTAATCCCCTTTAATTGATTTACTCTGCCTTTTGTGAGTGACAGGCATTGAAATGGGACACATACAATCACAGGGGTGTGCCTGCTTCTGTACCCTTGCAGTTGGTCTCTGTCATTAATTGTCATTGAGCTAATTTTCAACTCTCAGTTGTAGAAAAAA