Transcript asmbl_13001

Sequence
Transcript Sequence for observation asmbl_13001 of TGE0014739:
TTTCTGTGAGCACTTGGACCTCTCTTGGGACTTTCTTTTCCTATTCTGTTCTGATGGCATTTGGACAGCGTTTATGTTCGTGTCTGCGGGGGAGTCTGAGTCATTATTTGTGATTTTTAGAGACGGACGTTGACTGAAATGCTCTGGGTTTTTAAGCTCCAGCCCTGAGTTCTTCGCTGTTCTTACCCAGCCTCTTCCCACTGTTACCTCGTGCTCGAAACATGCAGCCCAGTTGAGCAGCCGATATGAGGAAACAGGCCCCGCAGGTCACACGGATCTGTGAATAAGCACACGAAACAAACAGAGCTTTCGTCACCGAGGGCAGACGGTTTGCTGCAACGGCACGAGGGTATTCGTGCAGAAGGAAATTCTCGACAGATTTACCGCAGAAGTGGTGAAACAGACCAAAAGGATAAAACTCGGGGACCCCCTTCTAGAGGACACCAGGATGGGCCCCCTCATCAACCGGCCACACCTGGAGCGTGTCCTTGGGTTCGTCAAACTGGCAAAGGAGCAGGGCGCTACAGTGTTATGTGGTGGAGAGCCCTACGTGCCCGAGGACCCCAAGTTAAAGGACGGGTTCTACATGACGCCTTGCGTGTTAACTCATTGCAGGGACGACATGACCTGTGTGAAAGAAGAGATCTTTGGACCAGTTATGTCCATTTTATCATTCGACACCGAGGCTGAGGTTCTGGAAAGAGCCAACGATACCACGTTTGGACTGGCCGCTGGCGTCTTCACCAGGGACATCCAGCGTGCTCACAGAGTGGTCGCCGAGCTCCAGGCCGGAATGTGCTTCATCAACAACTACAGCACCTCCCCCGTGGAGCTGCCCTTTGGAGGGTATAAGAAGTCAGGGTTTGGCAGAGAGAACGGCCGTGTGACCATCGAGTATTACTCACAGCTAAAGACTGTGTACGTGGAGATGGGCGATGTGGAGTCTGTGTTTTGAAATCGCGCCGTGAAACCCGTCGACGTGGCCAGGCCGAGGAACAGAGAGGACCGGCCCTCTCGGCGGGCCCGGCCTTCCCCATCCCCCACCCCCCTGCACCCCGCTTCCGTCACTGGGGACAGGATTCGTCACCCAGACATCTTCCTAACTGAAACTGTAGAAGTGCCTTCTCCTCTGCTGTTACGGTTTCCTTTGGAGGGTTGAGCAGCAGCAGGTGCTCTTCTCTGCCTCCCCGTCCAATCTTGTCTCCCAGAGGTAACTACTGTTAACACTTGGGTACTGGTTTTTCTAGGATTTTCTTCAAGGGGATAACTGCTAACGAACCCTTTATCTGGACGGGGCCTCGTGTAAGTGGG