Transcript asmbl_17349

Sequence
Transcript Sequence for observation asmbl_17349 of TGE0000432:
CACCCTCCCAGGAGCAAGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTGGTCTCGGCAGGCTCTTCGGGAAGGGGAAGAAGGAGAAAGGGCCAACCCCTGAAGAAGCAATACAGAAACTGAAGGAGACAGAGAAGATACTGATCAAGAAACAGGAATTTTTGGAGCAGAAGATTCAACAGGAGCTACAAACAGCCAAGAAGTATGGGACCAAGAATAAGAGAGCTGCCCTACAGGCTTTGCGGAGGAAGAAAAGATTCGAACAGCAGCTGGCACAAACTGACGGGACATTATCCACCCTGGAGTTTCAGCGTGAGGCCATTGAGAATGCCACTACCAATGCAGAAGTCCTTCGTACCATGGAGCTTGCTGCCCAAAGCATGAAGAAGGCCTACCAGGACATGGACATTGACAAGGTAGATGAACTGATGACTGACATCACGGAACAACAGGAGGTGGCCCAGCAGATCTCAGATGCCATTTCTCGGCCTATGGGCTTTGGAGATGATGTGGATGAGGATGAACTGCTGGAGGAGCTAGAGGAGCTGGAGCAGGAGGAATTGGCCCAGGAGTTGTTAAATGTGGGCGACAAGGAAGAAGAACCCTCAGTCAAATTGCCTAGTGTACCTTCTACTCATCTGCCGGCAGGGCCAGCTCCCAAAGTGGATGAAGATGAAGAAGCACTAAAGCAGTTGGCTGAGTGGGTATCCTGATAAATCTGGGCTTGTCTTCCTAATGCTACCTTTGTTGGTCCTTTCTTCCTTAAGTGCCAAGTGCTGAGCTAAAGGAGGATAACTTTTTGGGGAAGTCATGCTGAGGGTGGTAGTGTGACCCTGCCTGAAAAAAGGGTCTCTTACCCTCCCAGCCCTGGCTCAACTCTGAAGAAGGATCTTGCTACAGAAGGAGCCCTTGGGCTCCCTTCTCTTTGATAGCAGTTATAATGCCCTTGTTCCCAATAAAACTGGGCAGATGGAATCCTAGTGTCTATACTGCCTTGTCTACCCCTG