Transcript asmbl_12931

Sequence
Transcript Sequence for observation asmbl_12931 of TGE0003685:
CGCGCGCGCTCCCCGGGGAAGAGCAGGGGCGGCGTGGGAGGCTGGAGCCGAGTGTGAACCTGAGGAAGGAGCGGGGCCAGCGCGCAGGCCCGGAACCGCCGGAGCCGGGGCTGCCGGCGACGCCCCAGAGCGGAAGAGGGAAGTGAAGGCACCAGGCTGCGGGTTCCTGTCTGACTGGGCTTGCTAAGGTAGAGGCAGCACGGAGAAGAGGCCTTTGCCACCGCTCCGGATCGGAGATGTCGAAGAACACGGTGTCGTCGGCCCGGTTCCGGAAGGTGGACGTAGATGAGTACGACGAGAACAAGTTCGTGGACGAAGAAGACGGGGGCGACGGACAGGCGGGGCCCGACGAGGGCGAGGTGGACTCCTGCCTGCGGCAAGGAAACATGACAGCTGCCCTGCAGGCAGCTCTGAAAAACCCCCCTATCAACACCAAGAGTCAGGCTGTGAAGGACCGGGCAGGCAGCATTGTCCTGAAAGTGCTCATCTCTTTTAAAGCTAATGATATTGAAAAGGCAGTTCAATCCCTGGACAAGAATGGTGTGGATCTCCTAATGAAGTATATTTACAAAGGCTTTGAGAGCCCCTCTGACAATAGCAGTGCTGTGTTATTGCAATGGCATGAAAAGGCACTTGCTGCTGGAGGAGTGGGGTCCATCGTTCGAGTGTTGACTGCCAGAAAAACCGTGTAATCCAGCAGGAGCTGGATGTCTCCTGTGGGTGTGGGAATTGCTGGTACAAAGACCAAAACAACCAAATGCCACAGCTGCCCTTTGGGTAGCATCTATTTCTCTCAGCTTTGCCTTCTTGCTTCCTCTTTCATATCTATAAAGAAGAAAATTACATATCAGTTTTCCTTTAATGAAAATTGGGATGACATAGAGGGAATGTTTCAACAGAAGTGTTTCATGCTCTCAAAACTATTTCAGTGATGTGTATACCAATCTGTATATAGTATAATTTACATTCACGTTTAATTGTGTAATTTCTAACCCCTTAATTGGCTGGCATTTTTTGTTTTTCTGTTTTTTGTTTTTGGTTTTTTAGTTTTGTTTTTAACTAATAGTGATCTAAATTGGATGCTGGTTTCCTAACTCGTTGCTAGCCAGGAAATGACTCTTATAAAAAATATTTTTCAGAGACTGGCAGCTATTAACATTGCAAAACTGGACCATACTTCCTTTATTTAAGCAAAATGTGTTTCTGGGACAAGTGGTGGGTGAGCACCACTACCGCGTTCCAGTTTTGTTTCTGCTTGCCTCCAGATCATGTGAGTTTAAGTATGCTTCTTCCTCTCAGCATCCAATAATCATGGCCTCTCGATTTCTTTGGTCACCAGGGTCCAGAGCAAGGAGTCTTGCTCTATGCAGATGTATCTATAAAATACCAGAGCCTTTTTGGCATGAGCATAAAACTTTGTTTCAATTATGTGGCCCTATTTGGAGAAACTACTCCAAATCAGAAAGGACATGGAAACTATGATGTAGTTCAAACTCTGGGCGGCCTCCGAATGAAATGATACTTCCCATAGAGCTATAGTAGCTGCCTTAGACATTATGAGGTATATAACCAGTATTTAATATGCCCTATAAATGTCTTCAGTGTTCTTCAGGGTAATTGGGATCTCAAAAGATTTGGTTCAGATCCAAACACGCACACATTCTGTATTTTAGCTCAGTGGTTT