Transcript asmbl_12869

Sequence
Transcript Sequence for observation asmbl_12869 of TGE0003680:
CTTATTTGTCACTTGGTGACTGGTGTGTGCGGGGTCTGGTAGCCGCACTCTAGAAGGTTATTGCTCGCTGGCCCTCAGGTGTCCCGCTGATATCCCGGAAAATGACGGCTTCTTACGGCACGCGAACGACACCTCCCCGCTGCCACAAGAACCTTTTTCATTCTTGCCGCTTCGTTGGGATCTTTTTGATGACTCTAGTTATCCTGTTACCGACATCCTCCGATGCTTGTGATGATCCACCGAGATACGAATCTATGATGCTCAAGGATGTTTCTAAAGACTTGTATCTTCCTGGGGACCAAATAGAATTTAAGTGTCGCCTAGGATTCAAGCCTATTATACCTCTTCTTCCCACCACTGCTATTTGTCAGTCTGATAACACATGGACACCTCTCCAGGAGGCTTGTACAAGAAAATCATGTCCACAACTAGCAGACCCTTCAAATGGTCAAGTAAATGGAACTTTTCTGTTTGGTTCAGAGGTTCACTTTGTTTGTAATGAGGGTTATGAATTAGTTGGAACAAAAATTCTATATTGTGAAATTTCTGAAAATAATGTGGCTTGGAGTGGTGATCCCCCACAGTGTGAAAAGATTATGTGTCAACCACCTGGAGACATACCAAATGGAAAACATACCAGTAGCCACAAGGATGTATTTGAATATAATGAAGTAGTAATTTACAGCTGCAATCCTTCAGGAGGACCAGACGAATATTCACTTGTTGGAGAGAGCAGACTAGTTTGTTCTGGGAGAGACACATGGAGTAGTGCCCTTCCTGAGTGTAAAGTGGTCAAATGTCAATTTCCAGTAGTCAAAAATGGAAGACTGATAGCAGGATTTGCAAGAAAATTTTACTACAACGCGCAGGTTGTATTTGAATGCGTCCAGGGTTTTCACCTTAAAGGCAACAGCACAATTGTCTGTGGCGCTAACAATGAATGGCAGCCTAAGATGCCAGAATGTATTGAAGGTCTCAAGCCTACTAGTCCAGCCACATCTCCAGTTCCAAGACCCACAGATTCAGAACATGCCACTCCCGGTGATGAACCACCTAAATATTTAGGTGGAGGAATCATTGCTTTGATTGTTATTGTTACAGTTGTTGGCATTGCACTAATTTGCTGCATCGTGTGGATAGTTTTGCACAAAAAGAAGAAAAGGTTGCAGGAAAACCGTTGGGGTTAAAATTAAAGTTGCTGAGAGGGGGAANNNNNNNNNNTGCATACAGCTTACCATAATAAATCAAGCACTCCAGCAGAGCAGACAAACTAAACATTTTCCAAAAACGGGTGAAACACTTTATTTTTTGATTCTGTTAAAATGTCAAGATCTGCATTCAATTTGTATAGCTATTATTAAAACAGTATGGAGGCTCTTCAGATCATTAAAAACAGGACTATGTGGTTGACCAATTCCACTTCTGGGGATCTCTCCTAAGGAAACAAAATCACACTGTGAAAGAGATACCTGCACCTCCCTGTTCCTTGCAGAATTATTTACAGTAACTAAGACTTGGAAACAAGCTAGCTGCCATTAACAGATCATTGGATAAAGAAAATCAGGAATACATATACAGTGGAATACTACTCAGTCATAAAAACGGGAATCTTGATGACACGAATGGACCTTGAGGGCATTTTGCTATGTGAAATAAGTCATACACAGAGGCAAACACTGTGTGATCTATGTATAGAATCTAACTAACAAACTCAAAAAG