Transcript asmbl_12278

Sequence
Transcript Sequence for observation asmbl_12278 of TGE0003675:
GAGCAATTCATTTCTATTCTGTTCTCCCCGTTGTACCCACAAGCAGGTGACAAGTTCGTCTTCGCTACTAGACGATAAAGACAGCATTCAAGGAAGTCGTAAGGCAGCACGACTCCCCATCTTCCCATAGTAAAGATGGAGGCGCCCTGCATGTAAACGACAGGTAAAACTACTTCCGCCTTTCTCCTGCGCCCTCGTCCAAGATGGCGGACGAGGCCACCCGGCGTGTCGTGTCTGAGATCCCGGTGCTGAAGACTAACGCCGGACCTCGAGATCGGGAGTTGTGGGTGCAGCGACTCAAGGAGGAATACCAGGCTCTTATCCGGTATGTGGAGAACAACAAGAATGCGGACAATGATTGGTTCCGACTGGAGTCCAACAAGGAAGGGACTCGGTGGTTTGGAAAATGCTGGTACATCCACGATCTCCTCAAATATGAGTTCGACATCGAGTTTGACATTCCTATCACATATCCTACTACTGCTCCAGAAATTGCAGTCCCTGAGCTGGATGGAAAAACAGCAAAGATGTACAGGGGTGGCAAAATATGTCTGACCGATCATTTTAAGCCTTTGTGGGCCAGGAACGTGCCCAAGTTTGGATTAGCTCATCTTATGGCTCTGGGGCTGGGTCCATGGCTGGCAGTGGAAATCCCCGATCTAATTCAGAAAGGCGTGATTCAGCATAAAGAGAAATGCAGCCAATGAAGGATCAAGCCGCTGAGGCTGAGACTTGGATAGGCTACGTTCCTGTTTTCCTGTGCATCCCTCTTCTTACTCATCCGACCGCTTCACTCACACCCCTTCGCCTACAGCGGTTACTAAGTAGCTGCAGCGGTACAGTTTCCAGCATTGCCGGGGTGAAAAAACAGTGTTGCTACTGAGTTTCTAAGTTAGGCTGTACAGGGAGGGGAGAGGCTGGGGCTTTGGAAAAACCGAAAGGTAATTTATACCCCTTCCCCAGGCGGAGCGGTGTGAGATCCTGGAAGGACAGGGGATGGTTGAAAGTGGGTACACAGTCTTTTTGGTTTCCGGAAATAACTCATCAATAAAAGCTGCTTCTTCTGGTG