Transcript asmbl_12245

Sequence
Transcript Sequence for observation asmbl_12245 of TGE0008082:
AGCTGCAGAAACGGCGCGGCTGTTCCCACAAAGCGTGGCTAGCGGAGCGCCATGAGCAGAGCACCCAGCGATCTCAAGCTCAGGCTGGCCCGGGCTGGGCAGGAGCACCTGCTGCGGTTCTGGGATGAGCTGGAAGAGGCCCAGCGGGCGGAGCTCTGTGCGGAGCTCCAGGCCATGGACTTCGAGGAGCTGAGCATCTTTTTCCAGAAGGCCACCGAAGGAGTCCACCAGTTCTCTCAGCTGGAGAAGGTGGATGCGCGGATGGAGCCTATCCCTCGGGAAGTGCTGGGCAGCGCTACGCGGGATCAAGATCAGCTCCAGGCCTGGGAAAGTGAAGGACTTTTCCAGATTTCTCAGAACAAAGTGGCTGTTCTTCTTCTAGCTGGCGGACAAGGGACAAGACTTGGTGTCTCGTATCCCAAGGGGATGTACGATGTTGGGTTGCCATCTCATAAGACACTTTTTCAGATTCAAGCAGAGCGGATCCTGAAGCTTCAGCAGTTAGCTGAAAAATACCATGGCAACAAGTGCACCATCCCGTGGTATATAATGACGAGCGGCAGAACAGTGGAGTCCACAGAGGAATCCTTCACCAGACACAAGTACTTCGGTTTGAAAAAGGAGAATGTGATCTTTTTTCAGCAGGGAATGCTACCAGCCATGAGTTTTGATGGGAAAATTATTTTGGAAGAGAAGAATAAGGTTTCTATGGCTCCAGATGGAAACGGTGGTCTTTACCGGGCTCTTGCGGCCCAGAACCTCGTGGAGGATATGGAGCAGAGAGGCGTCGAGAGTGTTCACGTGTACTGCGTCGACAACATTCTGGTCAGAGTGGCGGACCCCCGGTTCATCGGATTCTGCATTCACAAGGGAGCAGACTGTGGGGCGAAGGTGGTGGAGAAGACGAACCCCACGGAGCCGGTGGGCGTGGTGTGCCGGGTGGACGGCGTGTACCGCGTGGTGGAGTACAGCGAGATCTCCCTGGCCACCGCGCAGCGGCGGGGCCCCGACGGGCGGCTGCTGTTCAGCGCGGGCAACATCGCCAACCACTTCTTCACCGTGCGGTTCCTGAGAGACGTGGTCAGTGTTTATGAACCTCAGTTGCAGCACCATGTGGCTCAAAAGAAGATTCCATTTGTGGATCCCCAGGGGCAGTTAATTAAGCCAGACAAACCAAATGGAATAAAGATGGAAAAGTTCGTCTTCGACATCTTCCAGTTTGCAAAGAAGTTCGTGGTGTATGAGGTGTTACGGGAAGACGAGTTCTCCCCACTCAAGAACGCGGACAGTCACAGTGGCAAGGACAACCCCACCACGGCCAGGCACGCTCTGCTGTCCCTTCACCACCGCTGGGTGCTCAACGCGGGGGGCCACTTCGTAGACGGAAATGGCTCCCGCCTGCCCGCGATTCCCTGGTAAGCCGGTGCCTTTGTCCCCAGGGGGCCGTGTCCCGGCCTGTCCTCTCCGACTCCGTTCTGCTCTCTCTGCTGTGCCCCCAGCCCCGGCATCGGCGTGGCCAGTCCCTGGGTGAGCCGAAGATAGCTCTGCCCGTTACGAAGAGTGCTGGCTTTGCCTCCTCTTACAGGGGAGTCTTCTAAGCTCTTGTTTCTCTGGAGGCGTCCGCAGCGTGTCACCAAAAGCCCCCTACTGAGGCACAGTCGGCAGGCCATTGCTTTGGTGTGCCTTCGGGTTCAAGCCCGCCAGAAGTGTGCCAGACCTCGGGGCGAGAGGGTGGGGCGTTGCTGGCTGTGTGTCAGGGGCCTCCCTACAAGGGTTCTCTGGGAGATCCCCAAAGTGCCACTGCCCGCACACCGTCTGCGAGACACAGGGCACCGCATCTTCCATGGCATTCAGGCCACTGAGGGAGGTGCCGGGAAGAGAAATGAATGCCAGTCGTGTTTACTGACACTAAAACTTCGGAAATGTTTTGGGAATTTAGACGCTAAAAAAATAAAAAGGTACTGATAGCTATTGAAATCTGAGATAAAGCTCTTTAAAGCTTAATCTTATATTTTATGATGAAATCTCCACTGGCACTTAGAATTCCCCCCTTCTAAATCATTTGACGTTTCTGTGCTTATATAAAGAACACTCTGCCGTGTAATTTGTATTCTTACGGGATAAAGGGGCTGGCTGTGGCACGCATGCGCAGGAGTGCCCGGAGGGGTGTCAGAGCACCGGGCGCCTGCACCGGCCACCGGAACCTACCGGTCTGTGCCGCGTCTCCACAAGGAGGGGCCCTGGCAAGCTGTCTCAGAGTCCGGGCCTCTTTCAGGCTGTCTTGCCATCCAGCTTGCTCTATGGCGTGACACGTTGTCCTCATGCTTCATCTCTGGCCATTGAGTTTGTTTCTTAACCCTTCAGATTTTCTTTGCCGGGTTTATAATTTGCCATAAATACGTGCCTTTCAGACAAGTATATTTTGCAGTTCCTCTTCTTTCTTACTGTTTTGGATTTTGTTTTTCATTCCCGTTAACGCTTATTTATTCCTGCGTAG