Transcript asmbl_12243

Sequence
Transcript Sequence for observation asmbl_12243 of TGE0003665:
AGCTGCAGAAACGGCGCGGCTGTTCCCACAAAGCGTGGCTAGCGGAGCGCCATGAGCAGAGCACCCAGCGATCTCAAGCTCAGGCTGGCCCGGGCTGGGCAGGAGCACCTGCTGCGGTTCTGGGATGAGCTGGAAGAGGCCCAGCGGGCGGAGCTCTGTGCGGAGCTCCAGGCCATGGACTTCGAGGAGCTGAGCATCTTTTTCCAGAAGGCCACCGAAGGAGTCCACCAGTTCTCTCAGCTGGAGAAGGTGGATGCGCGGATGGAGCCTATCCCTCGGGAAGTGCTGGGCAGCGCTACGCGGGATCAAGATCAGCTCCAGGCCTGGGAAAGTGAAGGACTTTTCCAGATTTCTCAGAACAAAGTGGCTGTTCTTCTTCTAGCTGGCGGACAAGGGACAAGACTTGGTGTCTCGTATCCCAAGGGGATGTACGATGTTGGGTTGCCATCTCATAAGACACTTTTTCAGATTCAAGCAGAGCGGATCCTGAAGCTTCAGCAGTTAGCTGAAAAATACCATGGCAACAAGTGCACCATCCCGTGGTATATAATGACGAGCGGCAGAACAGTGGAGTCCACAGAGGAATCCTTCACCAGACACAAGTACTTCGGTTTGAAAAAGGAGAATGTGATCTTTTTTCAGCAGGGAATGCTACCAGCCATGAGTTTTGATGGGAAAATTATTTTGGAAGAGAAGAATAAGGTTTCTATGGCTCCAGATGGAAACGGTGGTCTTTACCGGGCTCTTGCGGCCCAGAACCTCGTGGAGGATATGGAGCAGAGAGGCGTCGAGAGTGTTCACGTGTACTGCGTCGACAACATTCTGGTCAGAGTGGCGGACCCCCGGTTCATCGGATTCTGCATTCACAAGGGAGCAGACTGTGGGGCGAAGGTGGTGGAGAAGACGAACCCCACGGAGCCGGTGGGCGTGGTGTGCCGGGTGGACGGCGTGTACCGCGTGGTGGAGTACAGCGAGATCTCCCTGGCCACCGCGCAGCGGCGGGGCCCCGACGGGCGGCTGCTGTTCAGCGCGGGCAACATCGCCAACCACTTCTTCACCGTGCGGTTCCTGAGAGACGTGGTCAGTGTTTATGAACCTCAGTTGCAGCACCATGTGGCTCAAAAGAAGATTCCATTTGTGGATCCCCAGGGGCAGTTAATTAAGCCAGACAAACCAAATGGAATAAAGATGGAAAAGTTCGTCTTCGACATCTTCCAGTTTGCAAAGAAGTTCGTGGTGTATGAGGTGTTACGGGAAGACGAGTTCTCCCCACTCAAGAACGCGGACAGTCACAGTGGCAAGGACAACCCCACCACGGCCAGGCACGCTCTGCTGTCCCTTCACCACCGCTGGGTGCTCAACGCGGGGGGCCACTTCGTAGACGGAAATGGCTCCCGCCTGCCCGCGATTCCCTGCTTGAAGGATGCCCACGACGTCCCTATCCAGTGCGAGATCTCCCCTCTCGTCTCCTACGCCGGAGAGGGACTAGAAAGTTACGTGGCCGGCAAAGAATTCCACGCGCCTTTAATCATTGGCGAGAATGGCGTCTGTGAGCTGGTGAAGGACGGCGTATGAGCCAGGTGCCAAGTTCCCCGCAGCGAGAGCAGCGCTTACGTGTGACAGACCAACTGTGAGCCTCCAGGCCCCTCCTGAGGCTACTCAAGTTCGAATGTCCACGAGTCTCCTTCTGCCTGTCGAACTCTCCTAACTACTACGTAGCCCCTGAGAAGCAGCGGCCTGAACTGCAGAGAGCACCGTTAAGGTTCTCAACTCACTGACGGTCTTATTTATAGTTTTCAGTTGTATAAAATTTTCCCCAGGCCAAGGACAGCAGTGCCACCCACGCAGTTCCCTGCAGCGTGAGGGTGGCCAGGCGTGCGCCCGCCCTTCGCCTGGGGCTAGAAGCTTGTCTTCAGAGTTCTTCGGGGTGACAGTACGCCCTTGTACATGTCAGAAGGTTTCTGCGATACTACAAGTTTGTTTTATTTTATCAAAAGTAAGCTTTTTCAAGAAAATAATTGGACAGTAAAATAAACTTTTCTTTTTGTCTCTGG