Transcript asmbl_12178

Sequence
Transcript Sequence for observation asmbl_12178 of TGE0029277:
ATCTTGCTTCTTTTTCTCGCTCGCTCTCTCTCCCTGCTCGGGAAGAAGCGAAAGTGCTTTGGCGGTTTGTCCATCTGCAGCTGCGGCTCCCCCAGCCCGGTGGTCCTGCGGCCACCGCTGGCCCCAGCCTCCTCTCGCCCTTCCTTGGATCAGAGCTCGGCCGAAGCCCTCGAAGTGCGCACACACACTCAGCTTGACACCCTGGCCGACTGGTTTTAAGGGGTGTGGCAGGAGGTTTTGGACTCGATGAGTTTCCACCGAAATGTCGGAGAAGTCAGGCCAGAGCACAAAAGCAAAGGATGGGAAAAAGTATGCGACACTCAGTTTATTTAATACTTACAAGGGGAAGTCATTAGAAACTCAGAAAACCACAGTTGCAGCTCGACATGGATTACAGAGTCTTGGAAAAGTTGGAATTTCACGGCGGATGCCTCCCCCTGCTAACCTTCCAAGTCTCAAAGCAGAAAACAAAGGCAATGACCCTAATGTGAACATCGTACCGAAAGACGGCACAGGGTGGGCGTCAAAGCCAGAGCAGCATGAGGAAGAAAAAACACCAGAAGTTCCACCAGCACAGCCAAAACCTGGGGTTGCAGCTCCCCCAGAAGTAGCACCTGCTCCCAAATCATGGGCCAGTAACAAGCAAGGAATCCAGGTGAACAGTCATTTTCAGCAAGAATTTCCGAGCTTGCAGGCAGCTGGGGATCAGGAAAAAAAAGAAAAAGAAGCAACCGATGACAACTATGGACCTGGACCTAGTTTACGCCCACCAAATGTTGCTTGTTGGAGAGATGGCGGTAAGTCTGCTGGCCCACCCTTAACCTCTGACCAAGATGAAAAGCTCCCTGGCCAGGATGAAAGCACAGCTGGATCATCAGAGCAAAATGACATCCTCAAGGTGGTGGAAAAGAGGATAGCTTGTGGTCCTCCGCAAGCTAAACTCAATGGACAGCAGCCTGCCCTCACTTCCCAGTACAGAGCCATGATGCCTCCCTATATGTTTCAGCAGTATCCAAGGATGGCGTATCCTCCTCTTCATGGTCCCATGAGGTTTCCACCTTCTTTATCTGAAGCAAACAAAGGTCTTCGAGGAAGAGGCCCGCCTCCTTCGTGGGCCTCTGAGCCTGAACGCCCCTCCATCCTTAGTGCATCAGAGCTGAAGGAGCTCGATAAATTTGATAACCTAGATGCTGAAGCTGATGAAGGTTGGGCAGGTGCCCAGATGGAAGTAGATTATACAGAACAGCTGAATTTCAGCGATGATGATGAGCAAGGAAGTAGTAGTCCTAAAGAAAACAGCAGTGAGGACCAAGGTTCAAAAGCCTCTGAAAACAGTGAAACCCGAAAAGAAGCAGATGAAGTGTGCAATACTAAATCGTCATCTCAGATACCTGCCCAGCCACCAGTAGCAAAAGGTCCCTATGGGAAAGGACCACCATTTAATCAGGAACGTGGACCATCTTCCCACCTGCCACCACCTCCAAAGCTGCTTGCACAGCAGCATCCTCCTCCAGACCGACAGGCAGTACCTGGAAGACCAGGCCCTTTCCCCGCCAAGCAGCAAGTACCTGACGAAGATGAAATATGGAAGCAGAGAAGAAGACAGCAGTCAGAACTTTCTGCAGCGGTGGAACGTGCTCGTAAACGGCGTGAAGAGGAAGAGCGAAGGATGGAAGAACAGAGGAAGGCAGCTTGTGCTGAGAAATTGAAACAGTTGGATGAAAAGCTTGGTATCGTGGACAAGCAGCCATCTCCGGAGGAAATCAGAGAAAGGGAGCGGGAAAAGGAACGGGAGCGGGAGAAAGAACTCGAAAAAGAACAAGAA