Transcript asmbl_12175

Sequence
Transcript Sequence for observation asmbl_12175 of TGE0029276:
GGCGGGAGAGGGACGAAAAAAAAAATGCCGACGTGAGTGCGCAGGCCGCCGCCAAGGCCGGTGACAGCGGGTCCCCGCCGAAGCGGGACGTGGCCAAGCGCAGTTTCTCCAGTCAGAGGCCCGGCGTGGACCGCCAGAACCGGCGCGGCAACGGCGGCCCCCCCAAGCCCGGCAGGAACTTCTCGGGTCCCAGGAGCGACAGGAGAAGCGGCCCGCCCCCCAAGGGCGGGAAGCGCGGGCCGTTTGATGACCAGTCTGCAGGCACAGCGGGCGTCGACCCTCCCAGTGGCAGCTCCGCACACCATCAGGAGGGAGCACCTAATGGGACAGGACAGAAGAACAATAAAGATTCTGCAGGGAAAAAAAGAGAAGACCCCAAGCCAGGCCCTAAGAAACCCAAAGAGAAAGTGGATGCACTGTCACAGTTCGATCTCAACAATTATGCAAGTGTTGTTATAATTGACGACCATCCTGAAGTGACAGTAGTTGAAGACCCACAGTCAAATTTGAATGATGACGGTTTTACTGAAGTGGTATCCAAAAAACAACAGAAGCGTTTACAGGATGAGGAACGCCGGAAGAAGGAAGAACAGATCATACAGGTCTGGAACAAAAAGAATGCGAATGAAAAAGGACGAAGTCAGACTTCTAAGCTTCCTCCAAGATTTGCGAAAAAGCAGGCTACAGGGACCCAGCAAGCACAGTCTCCATCTGCAGCTCTGGCCACAGCTCCAGGTCCAGCCTCAGCCGCAGTCCTAACCTCACCCTCCACGCCACTACCAACGTCAGCCTCGGTGCCAGTGCCAGCTTCCACCTCAGCTACCACCCCCTCTTCTTCAGTTCCAGCTCCAACCCCCATCCTTGCCTCAGCTTCGACCCCAGCCTCTGTCCCCATCCTGACCTCAGCCTCAATTCCCATCCTTGCTTCAGCCCTGGCACCAACTTCAGCTCCAGCTCCAGCCAACTCATCCCCGACCGCCCCAGCCAACTCAACCCCAACTGCCCCAGCCAGTTCAGCCCCAGTCCCAACTCCAGCCTCACTCCCAGCCCAAGCCCCACTCCCAGCCCCGTCTCCAGCCCTAGTCAGTGTCCCAGGTCCCACCGCCTCAGCCCAAACTCAGGGACAGACTCACAAACCAGTCCAGAGTCCACTACAGACTTCAGCACAGCCTCCAAAACAGCCACCACCTTCAATTAGACTACCTTCAGCCCAGACACCTAATGGCACAGATTATGTAGCCACAGGAAAGGCCATCCAGACCTCACAGTCACATGGCACTCTAGCAACTGAACTGTGGGATAACAAGGTGGCCCCACCAACTGTGCTGAATGACATCTCAAAGAAATTAGGTCCCATTAGCCCACCACAGCCGCCTTCGGTCAGTGCCTGGAACAAGCCTCTAACGTCGTTTGGATCAGCTGCTTCATCAGAGGGAACAAAGAATGGTCAAGAAAGTGGAGTTGAAATTGGAATTGACACAATTCAGTTTGGTGCTCCAGCTTCAAACGGGAATGAAAACGAAATTGTTCCTGTGCTTTCAGAAAAAACTACTGACAAAATACCCGAACCTAAAGAACAACGGCAGAAGCAGCCACGGGCAGGCCCTATCAAAGCCCAGAAGCTTCCGGATTTGAGTCCAGTAGAAAACAAAGAGCATAAACCTGGTCCTATTGGAAAGGAACGATCATTAAAAAATAGAAAAGTAAAAGATGCCCAACAAGTGGAACCGGAAGGACAAGAGAAACCAAGCCCCACTGTCGTCAGAAGTGCAGATCCTGTGACAGCAAAGGAAACCAAAGCAGCTTCCGAAATGTCTGCTGAGATAGGAACAATGATCTCGGTGTCATCTGCAGAGTATGGCGCTAACGTGAAGGAGTCTGTAACAGACTATACTACACCTTCCTCTTCTCTGCCTAACACTGTGGCTACTAATAATGCAAAGATGGAGGATTCTTTGGTTAATAATGTGCCCCTGCCCAACACCCTTCCCCTCCCTAAGAGGGAGACTCTACAACAGAGCTCCAGCCTAACTTCAGTTCCTCCCACTACTTTCAGCCTCACCTTCAAGATGGAGTCTGCGCGTAAGGCGTGGGAAAATTCTCCCAACGTGAGGGAGAAGGGCTCTCCGGTGGCCTCTGCAGCGCCCCCCGTCGCCAGCGGCGTCAGCAGCGGCGCCAGCGGCCCGGGCACGGCCAGTTACAGCTCATTCTCCAGCGCGTCGGTGCCGCAGATCCCCGTCGCTTCGGTCACTCCTACGACATCGCTGTCAGGTGCTGGTACATACACTACCTCTTCTCTGAGTACAAAGTCCACAACCACGTCAGACCCGCCTAACATCTGTAAAGTGAAGCCCCAGCAGTTGCAGACAGGCAGCCTGCCCTCCGCCAGCCACTTCTCGCAGCTGAGCTGTGTGCCCTCCCTGATGGCCCAGCAGCAGCAGAGCCCACAAGTCTACGTGTCGCAGTCGGCAGCAGCTCAGATCCCAGCTTTCTACATGGACACCAGTCATTTATTCAATACCCAGCATGCACGATTGGCTCCACCATCGTTGGCCCAGCAACAAGGCTTCCAGCCAGGTCTTTCTCAGCCAGCTTCAGTTCAGCAGATCCCCATCCCTATCTACGCGCCGCTGCAAGGACAGCATCAGGCCCAGCTGAGCCTGGGCGCCGGACCGGCCGTCTCCCAGGCCCAGGAGTTATTCGGCTCGTCCCTCCAACCGTATAGATCTCAGCCAGCCTTCATGCAGAGCAGCCTGTCCCAGCCGTCTGTGGTCCTCTCTGGCACCGCCATCCACAGTTTCCCAGCTGTCCAGCACCAGGAACTTGCCAAGGCGCAGTCGGGCCTTGCCTTTCAGCAGACTTCAAATACTCAGCCCATTCCTATACTGTATGAACATCAGCTAGGCCAGGCATCGGGCCTGGGAGGGTCCCAGCTCATCGACACACATCTCCTCCAGGCTAGAGCAAATCTTACCCAGGCTTCAAATCTTTATTCCGGACAAGTACAGCAGCCTGGTCAGACAAATTTTTATAACACTGCCCAGTCACCGAGTACTCTCCAGCAGGTTACAGTGCCTCTGCCAGCATCCCAGCTCTCCTTGCCTAATTTTGGATCCACGGGGCAGCCGTTGATTGCTCTGCCCCAGACTCTGCAGCCCCCGTTACAGCACACCACCCCCCAGGCGCAGGCCCCCAGCCTGAGTCGGCCGGCACAGGTCAGCCAGCCTTTCAGAGGATTGATCCCCGCGGGAACACAGCACAGCATGATCGCGACCACCGGCAAAATGTCCGAAATGGAACTGAAAGCCTTTGGAAGTGGCATCGACATGAAACCAGGCACACCTCCCATCAGCGGCAGAAGCACCACACCCACCTCTAGTCCCTTCCGGGCCACGTCCACCAGTCCCAGCAGCCAGTCCAGCAAAATGAACAGCATCGTCTATCAGAAGCAGTTCCCGTCGGCCCCCGCCGCTGTGAGAATGGCACAGCCTTTTCCCACACAGTTTGCACCCCAGATTCTCTCTCAGCCTAACCTGGTCCCTCCATTGGTAAGAGCCCCACATACTAACACCTTCCCAGC