Transcript asmbl_12172

Sequence
Transcript Sequence for observation asmbl_12172 of TGE0014713:
GGCGGGAGAGGGACGAAAAAAAAAATGCCGACGTGAGTGCGCAGGCCGCCGCCAAGGCCGGTGACAGCGGGTCCCCGCCGAAGCGGGACGTGGCCAAGCGCAGTTTCTCCAGTCAGAGGCCCGGCGTGGACCGCCAGAACCGGCGCGGCAACGGCGGCCCCCCCAAGCCCGGCAGGAACTTCTCGGGTCCCAGGAGCGACAGGAGAAGCGGCCCGCCCCCCAAGGGCGGGAAGCGCGGGCCGTTTGATGACCAGTCTGCAGGCACAGCGGGCGTCGACCCTCCCAGTGGCAGCTCCGCACACCATCAGGAGGGAGCACCTAATGGGACAGGACAGAAGAACAATAAAGATTCTGCAGGGAAAAAAAGAGAAGACCCCAAGCCAGGCCCTAAGAAACCCAAAGAGAAAGTGGATGCACTGTCACAGTTCGATCTCAACAATTATGCAAGTGTTGTTATAATTGACGACCATCCTGAAGTGACAGTAGTTGAAGACCCACAGTCAAATTTGAATGATGACGGTTTTACTGAAGTGGTATCCAAAAAACAACAGAAGCGTTTACAGGATGAGGAACGCCGGAAGAAGGAAGAACAGATCATACAGGTCTGGAACAAAAAGAATGCGAATGAAAAAGGACGAAGTCAGACTTCTAAGCTTCCTCCAAGATTTGCGAAAAAGCAGGCTACAGGGACCCAGCAAGCACAGTCTCCATCTGCAGCTCTGGCCACAGCTCCAGGTCCAGCCTCAGCCGCAGTCCTAACCTCACCCTCCACGCCACTACCAACGTCAGCCTCGGTGCCAGTGCCAGCTTCCACCTCAGCTACCACCCCCTCTTCTTCAGTTCCAGCTCCAACCCCCATCCTTGCCTCAGCTTCGACCCCAGCCTCTGTCCCCATCCTGACCTCAGCCTCAATTCCCATCCTTGCTTCAGCCCTGGCACCAACTTCAGCTCCAGCTCCAGCCAACTCATCCCCGACCGCCCCAGCCAACTCAACCCCAACTGCCCCAGCCAGTTCAGCCCCAGTCCCAACTCCAGCCTCACTCCCAGCCCAAGCCCCACTCCCAGCCCCGTCTCCAGCCCTAGTCAGTGTCCCAGGTCCCACCGCCTCAGCCCAAACTCAGGGACAGACTCACAAACCAGTCCAGAGTCCACTACAGACTTCAGCACAGCCTCCAAAACAGCCACCACCTTCAATTAGACTACCTTCAGCCCAGACACCTAATGGCACAGATTATGTAGCCACAGGAAAGGCCATCCAGACCTCACAGTCACATGGCACTCTAGCAACTGAACTGTGGGATAACAAGGTGGCCCCACCAACTGTGCTGAATGACATCTCAAAGAAATTAGGTCCCATTAGCCCACCACAGCCGCCTTCGGTCAGTGCCTGGAACAAGCCTCTAACGTCGTTTGGATCAGCTGCTTCATCAGAGGGAACAAAGAATGGTCAAGAAAGTGGAGTTGAAATTGGAATTGACACAATTCAGTTTGGTGCTCCAGCTTCAAACGGGAATGAAAACGAAATTGTTCCTGTGCTTTCAGAAAAAACTACTGACAAAATACCCGAACCTAAAGAACAACGGCAGAAGCAGCCACGGGCAGGCCCTATCAAAGCCCAGAAGCTTCCGGATTTGAGTCCAGTAGAAAACAAAGAGCATAAACCTGGTCCTATTGGAAAGGAACGATCATTAAAAAATAGAAAAGTAAAAGATGCCCAACAAGTGGAACCGGAAGGACAAGAGAAACCAAGCCCCACTGTCGTCAGAAGTGCAGATCCTGTGACAGCAAAGGAAACCAAAGCAGCTTCCGAAATGTCTGCTGAGATAGGAACAATGATCTCGGTGTCATCTGCAGAGTATGGCGCTAACGTGAAGGAGTCTGTAACAGACTATACTACACCTTCCTCTTCTCTGCCTAACACTGTGGCTACTAATAATGCAAAGATGGAGGATTCTTTGGTTAATAATGTGCCCCTGCCCAACACCCTTCCCCTCCCTAAGAGGGAGACTCTACAACAGAGCTCCAGCCTAACTTCAGTTCCTCCCACTACTTTCAGCCTCACCTTCAAGATGGAGTCTGCGCGTAAGGCGTGGGAAAATTCTCCCAACGTGAGGGAGAAGGGCTCTCCGGTGGCCTCTGCAGCGCCCCCCGTCGCCAGCGGCGTCAGCAGCGGCGCCAGCGGCCCGGGCACGGCCAGTTACAGCTCATTCTCCAGCGCGTCGGTGCCGCAGATCCCCGTCGCTTCGGTCACTCCTACGACATCGCTGTCAGGTGCTGGTACATACACTACCTCTTCTCTGAGTACAAAGTCCACAACCACGTCAGACCCGCCTAACATCTGTAAAGTGAAGCCCCAGCAGTTGCAGACAGGCAGCCTGCCCTCCGCCAGCCACTTCTCGCAGCTGAGCTGTGTGCCCTCCCTGATGGCCCAGCAGCAGCAGAGCCCACAAGTCTACGTGTCGCAGTCGGCAGCAGCTCAGATCCCAGCTTTCTACATGGACACCAGTCATTTATTCAATACCCAGCATGCACGATTGGCTCCACCATCGTTGGCCCAGCAACAAGGCTTCCAGCCAGGTCTTTCTCAGCCAGCTTCAGTTCAGCAGATCCCCATCCCTATCTACGCGCCGCTGCAAGGACAGCATCAGGCCCAGCTGAGCCTGGGCGCCGGACCGGCCGTCTCCCAGGCCCAGGAGTTATTCGGCTCGTCCCTCCAACCGTATAGATCTCAGCCAGCCTTCATGCAGAGCAGCCTGTCCCAGCCGTCTGTGGTCCTCTCTGGCACCGCCATCCACAGTTTCCCAGCTGTCCAGCACCAGGAACTTGCCAAGGCGCAGTCGGGCCTTGCCTTTCAGCAGACTTCAAATACTCAGCCCATTCCTATACTGTATGAACATCAGCTAGGCCAGGCATCGGGCCTGGGAGGGTCCCAGCTCATCGACACACATCTCCTCCAGGCTAGAGCAAATCTTACCCAGGCTTCAAATCTTTATTCCGGACAAGTACAGCAGCCTGGTCAGACAAATTTTTATAACACTGCCCAGTCACCGAGTACTCTCCAGCAGGTTACAGTGCCTCTGCCAGCATCCCAGCTCTCCTTGCCTAATTTTGGATCCACGGGGCAGCCGTTGATTGCTCTGCCCCAGACTCTGCAGCCCCCGTTACAGCACACCACCCCCCAGGCGCAGGCCCCCAGCCTGAGTCGGCCGGCACAGGTCAGCCAGCCTTTCAGAGGATTGATCCCCGCGGGAACACAGCACAGCATGATCGCGACCACCGGCAAAATGTCCGAAATGGAACTGAAAGCCTTTGGAAGTGGCATCGACATGAAACCAGGCACACCTCCCATCAGCGGCAGAAGCACCACACCCACCTCTAGTCCCTTCCGGGCCACGTCCACCAGTCCCAGCAGCCAGTCCAGCAAAATGAACAGCATCGTCTATCAGAAGCAGTTCCCGTCGGCCCCCGCCGCTGTGAGAATGGCACAGCCTTTTCCCACACAGTTTGCACCCCAGGCAAAGCAGAGAGCAGAGGTGCTTCAGTCCACGCAGCGGTTCTTCTCTGAGCAGCAGCAGAGCAAACAGATAGGAGGCAAAGCCCAGAAAGTGGACAGTGATTCAAGCAAGCCTCCTGAAACGCTGACCGACACTCCTGGTGTCTGTCAGGAAAAAGCAGAAGAAAAGCCACCCCCCGCGCCCGCCATAGCCACCAAACCTGTTAGAACTGGACCAATCAAACCTCAGGCGATCAAAACCGAAGAAACAAAATCTTAAAAGGCTGTGGTTTATTCCGGGGGGGCTGGGGGCGGGGAGAGGGGAAAGAGGAAGAATGAAGTGAGATGATGCCCCCAGCCAGAGCGGCCGGCGGCCTCTGACATTCTCCTTTCCAGAGCTCGGAGGTGCCCGGGGACACAGCGGCCGTTCACACTGACGCACAGCTGCTGTCAGCTTGCACCTACCGTACAACACGCACTCTGCCGATGGCCATGCGTCTTCAGTCAATTTACATACAAACACACACATGCACGCATTTCTCGAGTGGATGTAATTTAGAACTAAATCCTTATGGTTAGATGAAACACCAGAGGTAAGAGGAAAATAGCCCGGCCGAGGGAAAGCTCGGCCTGACCAGTGCGGAGGTCCCAGCCGAATGCATCACATGTGGTTTCTTGGCTCCCTTCTGTCCTCCGGATGTGGTGACAGCATTTGTAGGCTTGGTGGTGAGACACTGAAGATGACTGGGGCTGGAGAGAGGGGCCTTGTTTTCGAGTCTGGCAGCTTGCTGTGTTTTGTAACATGGCGATAGAGTTGAATACAATCAGAGTACAGTAACCGACCTCCTCTTCTCCCTGGACGAGCGAGCAGATGATGAATTAGCGCTGCCCGCGTCCTGACATACCCGAGCGGGCGGTGTGGGGCTCCTGCTTCTGTCTGAAACGATGCTGTGTTGTGGCCATGGTCGAAGCTCTGCAGTGCTGCTTGGCGTCTGCCCCGTGGCGCGCTCGCCGCTCAGACGGCGGATCTGGGGAGGCGCTCGTTAGGCTGGGTCTTGCTTGCCTCCGCGTGGTCATCTCTATGAATCCAATGGGTTGTGGGTTTTTTTTTCCCCCCG