Transcript asmbl_11761

Sequence
Transcript Sequence for observation asmbl_11761 of TGE0003620:
GGCAGGAGGAAGGGGTGCGGTCGCAGTCGCGGTCACGGTCGCGGGCCGGGAACGAGCTCCGAACACCAGCCCGCGAGGCCGCACACCTGTCTGGCTGTTCTGCCGCACACCAGTCCCCGCAGCCTCGCTTCAGGGTTAGTGTGACCTGAACTTAAGGCAAAGGTGGTATATCATGGCATCTCTCTGGGTTGGACACCGAGGGACAGTGCGAGATTATCCAGGCTGTAGCCCATCAGTGGATGCTGAAGCGATTCGTAAGGCAATCAGAGGAATTGGAACTGACGAGAAAACACTCATCAGCATTCTAACTGAGAGGTCAAACGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCGTATGACAAGGAACTGAAAAATGACTTGAAGGGCGACCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTCGTGACTCCTCCAGCAGTGTTTGATGCGAAGCAGCTGAAGAAATCCATGAAGGGCACTGGAACAAATGAAGATGCATTGATTGAAATCTTAACCACCAGGACAAGCAGGCAGATGAAAGAGATCTCTCAAGCCTACTACACAGTATATAAGAAGAGTCTTGGAGATGACATTAGTTCTGAAACATCTGGTGACTTCCGGAAAGCTCTGTTGACTTTGGCAGATGGCAGAAGAGATGAAAGTCTGAAAGTAGATGAGCATTTGGCCAAAAAAGATGCCCAGATTCTCTATAATGCTGGTGAGAACAGATGGGGCACGGACGAAGATAAATTCACTGAGATCCTATGTTTAAGGAGCTTTCCTCAACTAAAACTAACATTTGATGAATACAGAAATATTAGCCAGAAGGACATTGAGGACAGCATAAAAGGAGAATTATCTGGGCATTTTGAAGATTTGCTGCTGGCCATAGTTCATTGTGCAAGGAATATGCCTGCCTTTTTAGCTGAAAGACTACATCAAGCTTTGAAGGGTGCTGGAACTGATGAGTTCACTCTGAACCGAATAATGGTTTCCAGATCAGAAATTGACCTTTTGGACATTCGAGCAGAGTTTAAGAAGCAGTATGGCTACTCCCTAAATTCAGCAATTAAATCGGATACTTCTGGAGACTATGAAATCACACTCTTAAAGATCTGTGGAGGAGATGACTGAGTCAAGAACATCATCTCCAAAGGTTGTTTGCTTCCATGATGGGCTTCTCCAACAGCTCTGCTTACTTCTCTTTCACGGGATTTAAAAGTACAAGAAGTATAAACAGCAATCTGTTTTTCGTAACAGAAATTGTCATTGTTCCATAACAACAACAAAGTGATTATCTTAAAGTATTTCATCATAATGTAGTAGTTTATAAGTGAAAATTTAAAATGGTATAAAGAATCCGCTAATACTCTCCAAATTATATTTCTACTTAGGAAGTGAGAATCATTGTACAGTTCTAAAACATTAAATGCAAAAACAAGGTAATAAAAGTTGTCACCTTTGTTAAA