Transcript asmbl_11474

Sequence
Transcript Sequence for observation asmbl_11474 of TGE0003610:
CAAAGGACTCAGGTGCAGGCTTCCCTAACGGACTAGTCTCGCACCTAAAGAAGAAAGAAAATGGCCTGTGCCGAGTATTCTTTTCATGTGCCGAGTCTAGAGGAGCTTGCTGGAGTTCTACAGAAGGGACTAAAGGATAACTTTGCTGACGTCCAGGTTTCTGTAGTTGATTGCCCTGATTTGACTAAAGAGCCATTTACCTTTCCTGTGAAAGGCATCTGTGGGAAAACTAGAATTGCAGAAGTAGGAGGTGTGCCTTACTTATTGCCTCTTGTAAATAGAAACAAAGTCTATGATCTAAATAAGATTGCAAAAGAAATCAAGCTTCCTGGAGCTTTTATTCTTGGAGCGGGGGCAGGCCCATTTCAGACTCTCGGGTTCAATGCTGAGTTTATGCCAATTGTTCAAACAGAAAGTGAACACAAACCTCCTGTGAATGGAAGTTACTTTGCCCGTGTTAACCCTGCAGATGGAGGATGCTTACTAGAGAAATACAGTGAGAAATATCGTGATTTTGGGTGTGCATTACTGGCTAATCTTTTTGCCAGTGAGGGCCAACATGGAAAGGTCATTGAGGTGAAAGCCAAAAGAAGAACTGGAAAACTTAACTTTGTGACTTGTATGAGACAGACTCTTGAAAAACATTATGGAGATAAGGCTGTAGGGATGGGAGGTACTTTCGTAATTCAGAAGGGAAAAGTGAAGACTCACATTATGCCTGCAGAATTTCCTTCCTGCCCTTTGAACTCTGAGGAAAAGGTGAATGAATGGTTGAATTTTTATGAGATGAAGGCTCCTTTGATTTGTCTGCCAGTTTTTGTCTCCAAAGACCCAGGATTTGATTTGCGATTGGAGCACACTCACTTTTTCAGTCATCATGGAGAAGGTGGACACTACCATTATGACATTACCCCAGATATAGTAGAATATCTTGGCTACTTCTTACCTGCGGAGTTTCTTTATCGCATTGATCAACCAGAAGAGACCCATTCATATGGGCGAGATTAAATCAACTGATCAGCATTTAGAAAAAGAAGTGATTAACTAAAGTTAATTAAATGATTAACTCATTAATTGCTACAAATATAAAGTTCAATAGAAATGATCTTACTACTTAAACCCTATTTTTTTGGCCTTTGAAATGAAAGGTATGTTGACATTACTCTGTTATTTCATAGATCTGAAAAAGTTTCTTGGGAACAAAGATATATAATGGAGATGTTCTTCATTATTTTTTTATTCTAAAAATCAGTCTTATATTT