Transcript asmbl_22223

Sequence
Transcript Sequence for observation asmbl_22223 of TGE0004241:
CAAACATCTCTCCGCTCCATCCCAATTCTGTTGGGACTTCGGGGCCTACCCTGTCCGGACCCGGGAGCTGGGAGGCGGCGAGACCGGTCTGCGCCCCCGAGAGGACGAGTCACCAGGTTTCAAGATGCTGCGAGTACGTAGGACCGAGCTGTGCAGGTTGGGGCTCGGCCTCTCCAGGGGGCTTCACCAACAGCCTGTGATGGCCCTGAGGCGGGAGGACGTGAACGCCTGGGAGAGGAGGGCCCCTCTGGCCCCCAGGCACATCAAGGGGATCACCAACCTGGGATACAAGGTCTTAATACAGCCTTCCAATCGGCGGGCCATTCATGATAAGGAATATGTCAAAGCTGGTGGCATTCTTCAGGAGGATATTTCTGAAGCCTGTCTAATTTTGGGAGTTAAAAGACCCCCAGAGGATAAATTAATGTCCAAGAAGACTTATGCATTCTTCTCCCACACAATAAAGGCCCAGGAGGCCAATATGGGCTTATTGGATGAGATTCTAAGACAGGAAATCCGACTTATTGATTATGAAAAAATGGTGGATCATAGAGGAATTCGGGTAGTGGCGTTTGGACAGTGGGCTGGTGTGGCAGGGATGATCAACATTTTACATGGAATGGGTTTAAGGCTCCTTGCTTTGGGACATCATACACCTTTTATGGGAGCCCAAGAAGTCTTCAATGAACTACCCTGTGAATATGTGGAACCACATGAATTAAAAGAAGTTTCTAAAACTGGTGACCTGAGAAAAGTGTATGGAACAGTGTTAAGTCGCCATCATCATCTTGTCAGGAAAACAGATGGTACATATGATCCCGTAGAATATGACAAATATCCTGAGCGCTACATAACTCGTTTTAATACCGATATTGCACCCTATACAACTTGTTTTATTAATGGAATCTACTGGGAGCAAAACACCCCTCGTCTACTAACCCGCCAAGATGCTCAAAGCCTCCTGGCTCCAGTCAAGTCTTCAGTTGTCGGTGTGGAAGGCTGCCCTGCATTGCCACACAAACTTGTGGCAATATGTGACATTTCAGCTGACACAGGAGGGTCTATCGAGTTTATGACCGAGTGTACAACAATAGAGCGTCCTTTTTGCATGTATGATGCAGACCAGCATATTATTCATGACAGTGTTGAAGGCTCTGGGATTCTGATGTGTTCCATTGACAATTTGCCAGCACAGCTTCCAATTGAAGCTACAGAATACTTTGGTGACATGCTTTATCCTTATGTCGAAGAAATGATATTATCAGATGCAACACAGCCTCTTGAAAGTCAGAATTTTTCTCCTGTGGTGAGAGATGCAGTGATTACATCCAACGGTACATTGCCTGATAAGTATAAATATATCCAGAAACTCCGAGAGAGCAGGGAACTTGCTCAGTCACTTTCAATGACTACCAAGAAAAAGGTCTTGGTTCTTGGAAGTGGTTATGTATCTGAGCCTGTACTGGAATATCTGTCGAGAGATGACAACATAGAAATAACAGTAGGCTCTGACATAAAGAATCAAATTGAACAGTTAGGCAAGAAATATAACATTAGTCCTGTTATCATGGACATTGGTAAACAAGAAGAGAAATTGGTCTCCTTGGTGGCAACACAAGATCTTGTCATCAGCTTGTTGCCTTATGTATTGCATCCTCTTGTGGCCAAGGCATGCATCACAAGCAAAGTTAACATGATCACTGCAAGCTATATCACACCAGCACTAAAAGAATTAGAGAAGAGTGTGAAAGATGCTGGCATCACAATCATTGGAGAATTGGGATTGGACCCTGGTCTTGATCACATGTTGGCAATGGAAACAATAGATAAGGCCAAAGAAGTAGGAGCCACGATTGAATCTTATATTTCCTACTGTGGTGGGCTTCCAGCCCCTGAATATTCAGACAATCCTCTGAGATACAAGTTTAGCTGGAGTCCCACGGGAGTCTTGATGAACATAATGCAGCCCGCCACCTACCTCCTCAATGGCAAGGTTGTGAATGTCAAAGGGGGCGTCTCCTTTCTCGATGCGGTTACTCCCATGGATTATTACCCCGGACTAAATTTGGAAGGCTACCCTAACAGAGACAGCACCAAATACGCTGAGGTTTATGGCATTCCCTCTGCTCACACGTTGTTGCGGGGTACACTGAGATATAAGGGATATGCCAAAGCCTTGAATGGGTTTGTGAAATTGGGTCTTATAAACAGAGATGCATTTCCTGCCCTTAGACCTGAAGCCAAGCCTCTCACCTGGAAAGAGCTCCTCTGTGATCTAGTTGGGATTTCACCCTCCTCCAAGTCCGATGTGCTCAAGGAAGCCGTCCTTAAGAAACTAGGAGGGGACAATACCCAGCTGGAGGCTGCTGTATGGTTGGGCTTGCTTGGGAATGATCAGGTCCCTCGGGCAGAGTCTGTTGTGGAAGCGCTCTCCAAGCATTTAGCCACAAAACTTTCGTACGGTCCCGGAGAGAAAGATATGATTGTGATGAGAGACAGCTTTGGAATCAGACATCCTTCTGGACATTTAGAAAGTAAAACTATTAATCTCGTGGTTTATGGAGACACCAAAGGCTTTTCAGCCATGGCTAAAACTGTGGGATTACCCACCGCGATGGCAGCCAAGATGTTGCTTGATGGTGAAATTCAAGCTAAAGGCCTGATTGGGCCCTTTTCAAAGGAGATCTATGGACCAATATTGGAGCGAATTAAAGCAGAAGGCATTATCTATACTACACAGAGCACAACCACACTTTAATTGAGAATTATTTTGTTTTTACCTTCTCAGGCAACACAGCTCTGAGCATTTGTGCAACAACCATGTTTGCTACTGTGCTGTTTTAAACTACAAAACATGATATGTTTTTGAATAAGTCATTACAGTGATGTTTTTGAAATATAAATGTCTATTTTAATATGAAAACATTTGAAACAGGAAATGCCAGTGATAGAGAACTTTAATAATTCTACTATGTATTTTTTCACATGTATGTAGAAGTGATAATGAGTTATTAATTTATTGTGCAACTTTTTTCCTACAAGAATATATTTTCCTATACTCAGCAGATGCAGTTTTATCTTTTTAGATATAAAAAAGTTTCCTCAATAACATAGCAATGCAAAGGATCATAAGAGACTACTACAAACAATTATATGCCAATACACTGGAAAACCTAAAAAATGAATCAGTTCCTAGAAACATACAACCTTCCAAGACTGAATCATGAAGAAATAGAAAATAGACCAATTATAAGTAATGACACTGAATCAGTAATTTAAAAACTCCCCAAAACAAAAAGTCCAGGACCAGATGGCTTCACAGGTGAATTCTACCAAACATTTATGAAGAGTTGACACTTACCTTTCTTAAATTATTCCCAAAAAATTAGTGAGGAAGGAACACTTCCAAACTCCTAGGAATAGATTGAGAGTCTAGAAATAACCCTCACATTTATGGTCAACTGATTTTTTAAAAGGGCGCTAAGACAGTTTAATAGAGGAAAATAGTGTTTTCAACAAATGGTGCTGGAACAGCTGGATATCCACATGTGAAGGAATTGGAAATTGGACCCTTACCTCACAGTCAAAATTAATTCAAAGTGAACCAAAGGCCTAGTTACAAGGGCAAACACCATAAAACTTTTAGAAAAAGTCATAGGCATAAATATTCATGATCTTGGATTGGATAATGGTTTCTTAAGTAAATGACACCGAAAGCATGAGCAATAAAAGGAAAAAAATACATAAATTGAACAGCATCAGAATTAAAACTTTTCTGTTTCCAAGGATACCATCAAGA