Transcript asmbl_11069

Sequence
Transcript Sequence for observation asmbl_11069 of TGE0003597:
GTCGTCGTCGGGGGTGGTAGCGGCAGAGGGGGCGGCGGCAGTGGCAGCATTGGGGACGGCAGCCGTGAAGGCGACGGTGGCGCAGGGCCGGGGACGGGGGGAATGAGGAGGCCGCGGCGGGCCAGCGGCGGAGCTGTGTAGCGGATAAGCGGCTCCCCCTCCTTCCCTTGGTTGAGTCGGGGGCGCGCGCGCGAGCGCGCGGCCGTCCGGAACGGGCTTCCCACCCTCCACTCCCGCGACCCGCACGGCACCCCCACCCGGGCCCGGAGGATGATGAAGCTCAAGTCGAACCAGACCCGCACTTATGACGGCGACGGCTACAAGAAGCGGGCCGCGTGCTTGTGTTTTCGCAGCGAGAGCGAGGAGGAGGTGCTACTTGTGAGCAGTAGTCGCCATCCCGACCGATGGATTGTCCCTGGAGGAGGAATGGAGCCAGAGGAGGAGCCAAGTGTGGCAGCAGTCCGTGAAGTCTGTGAGGAGGCTGGAGTAAAGGGGACATTGGGAAGATTAGTCGGGATTTTTGAGAACCAGGAAAGGAAGCACAGAACATATGTCTATGTGCTCATTGTCACGGAAGTGCTGGAAGACTGGGAAGATTCAGTTAACATTGGAAGGAAGAGGGAGTGGTTTAAAATAGAAGATGCCATAAAAGTGCTGCAGTATCACAAACCGGTGCAGGCGTCGTATTTTGAAACATTGAGGCAAGGCTACTCAGCCAACAATGGCACCCCGGTCGTGACCACCACATACTCAGTTTCTGCTCAGAGCTCTATGCCAGGCATCAGATGACTGAAGACTTCCTGTAAGAGAAATGGAAATTGGAAATTAGACTGAAGTGCAGATCTTCCCTCTCACTCTTGCTCTTTTCACCTCTCTTCACAGGCCTCCTCTTTCAAATAAGGCATGACGGGCAGCAGAGGAAGGGTTTATTGATAATGTTCCTGTTTGGTGTTAAGTGATGGGGCTTTTTCTTCTCGTTTTTTTTTGAGGGGGGTGGGGGTTGGGTATGTAATTTGTAAGTACTTTTGTGCATGATCTGTCCCTCCCTTTTCATACCTCTACAATTCTCTAAAAAGAGGCAGACAGCCTTCCCTTTGCCTTGGATTCTGAAGTATTCCTCTTTGTCTCATCCCATCCCTGGCCAGACATTTTTCTTTGATTTTTAATTTTTTTAAATTAAAAGCTACCAATATGAGATAAAAACTTTCAAGAATTTGTTCTGTAATGTGCTGTTCAGTCCAGTAGGTTGGTCAGTTTCACTGCAGAATACATTTATCTACACATTATATACTGGGCATATAATATGTAAATAAATGACTTTTAGAAGAAAAATTTAACAGTTTAAATTTTTTTCAAGGTTTTGTTTTGTTTTTTAAATTTGGGGTGTTTCTGAAATGGAGAGCCTCACAATTTACTTTTTAATTTTTCCTGCTAGTGTCTAGATAAGTCTTCCTGTCCTTTCTCTTTTCCCCAGTCATTGATGTAGTTATGTAAGGTAAGGGAAGAGTTTAGCTACCTTCCTAGTGCTCCCAGGACTCATAGCCTTCTCTTCGCAAGCTGTGTTTCCATGCCAAGAAAGAAACAGGAAGAAACCTATTTGCTTTTTTATTACCAAGCCAGGAGCAAATGGCCTCAGCTCAGATTTGGAGAAACAGTGATAGCAATTGAATTCCTCCCTTGTATGTTGACAATAGGGATTTGAACTGGATTCTTGGGATTACTATCTAAAAAACTGGAGCATCAAGCACTGTTTCTATCCTGCTAGTTTGGAATTTTTTCCATAATGCTACTTACTACCGACAACAGCCTCTCTCCTGTGCATACATGCCTTACAGTGTGCCGAACTAGATATTGTCCTTGTGCTCTGAAGCATCCAGGTGCATCTGTACAGTCCTGTCCCCATCCTGGGTAACCTTGTTAAGTTCCTGAAAAGTACACAGGAGGAAAGTTCAGGTGTTTGCTGATCTTCGTAATGTTATATAGCTCTTGTAATTGCACCATGGAGCATGCTCAGAAATACTGAATTTGTCTCCCACTGGGATGTGAAAGGTCCATCTTCTGCTGAGAAGTGATATGGGAGAAGCTTAATCATTTACTAGAACAGCTACATAATGCATTAGCTCACTGCAAACTGTCTTGTTGGTTTTTAGTACAGGTTTCATGTTGGTTTCATTTGCCAATTGAGTTGTTTAGTTGAGAAG