Transcript asmbl_10960

Sequence
Transcript Sequence for observation asmbl_10960 of TGE0003586:
CGGAAGTTCCACGTCAGTCAGTCGGCGGGTCAGCGGGTCGGTGGGACTCTTCGGGGGTGCGTTGTCATTTGCAAGTGAGGCGTCTGGCCTCGGACTGAAGAAGCCATGCCTTTACGACTTGATATCAAGAGAAAGCTAACTGCTCGATCTGATCGAGTTAAGAGTGTCGATTTGCATCCTACAGAGCCATGGATGTTGGCGAGTCTTTACAATGGTAGTGTGTGTGTTTGGAATCATGAAACACAGACACTGGTGAAAACATTTGAAGTGTGTGATCTTCCTGTTCGAGCTGCAAAGTTTGTTGCAAGGAAGAATTGGGTTGTGACGGGAGCGGATGACATGCAGATTAGAGTATTCAATTACAATACTCTGGAGAGAGTTCACATGTTTGAAGCACACTCAGACTACATTCGCTGTATCGCCGTTCATCCAACCCAGCCTTTCATTCTAACTAGCAGCGATGACATGCTTATCAAGCTCTGGGACTGGGATAAAAAATGGTCTTGCTCACAAGTGTTTGAAGGACACACCCATTACGTTATGCAGATCGTGATCAACCCCAAAGATAACAATCAGTTTGCCAGTGCATCTTTGGACAGGACCATCAAGGTATGGCAGCTGGGCTCTTCGTCACCAAACTTCACTTTGGAGGGACATGAGAAAGGCGTCAATTGCATCGATTACTACAGTGGTGGCGACAAACCATATCTCATTTCAGGTGCAGATGATCGTCTGGTTAAAATATGGGACTATCAGAATAAAACATGTGTACAGACACTGGAGGGACATGCCCAAAATGTGTCTTGTGCCAGTTTTCATCCTGAGTTGCCAATCATCATCACAGGTTCAGAAGATGGCACCGTGCGTATATGGCACTCAAGCACATACCGCCTTGAAAGCACACTGAATTATGGAATGGAGAGAGTATGGTGTGTGGCCAGCCTGAGAGGGTCCAACAATGTTGCTTTGGGCTATGATGAAGGGAGTATCATTGTTAAGCTTGGTCGGGAGGAACCTGCCATGTCCATGGATGCCAATGGAAAGATAATTTGGGCCAAGCATTCAGAAGTCCAACAGGCCAACCTAAAAGCAATGGGAGATGCTGAAATTAAAGATGGAGAAAGATTGCCACTGGCAGTAAAGGATATGGGCAGTTGTGAAATATACCCTCAGACTATTCAGCACAATCCTAATGGGAGGTTTGTTGTGGTGTGTGGTGATGGCGAGTATATCATCTACACAGCAATGGCATTGAGAAACAAGAGCTTTGGGTCTGCCCAGGAGTTCGCATGGGCCCATGATTCTTCAGAATATGCAATAAGAGAAAGCAACAGTGTTGTAAAGATATTTAAGAACTTTAAGGAAAAAAAATCATTTAAACCAGATTTTGGAGCTGAAAGTATCTATGGAGGCTTCTTATTGGGAGTCAGGTCTGTAAATGGCTTAGCTTTCTACGACTGGGACAATACAGAACTCATACGCAGAATTGAAATTCAGCCCAAACACATTTTCTGGTCTGACTCTGGAGAGCTAGTCTGTATTGCTACTGAGGAGTCATTTTTTATCCTTAAGTATCTGTCAGAAAAAGTCTTGGCTGCACAGGAAACACATGAGGGAGTCACTGAAGATGGCATTGAAGATGCCTTTGAGGTTCTTGGTGAGATTCAGGAAATTGTGAAAACAGGGCTGTGGGTAGGCGATTGCTTCATTTACACAAGTTCTGTGAACAGATTAAATTATTATGTCGGAGGAGAAATAGTCACCATTGCCCACTTGGACAGGACGATGTATCTCCTGGGCTATATCCCTAAAGACAACAGGCTTTATCTGGGGGATAAAGAACTGAACATCGTTAGCTACTCACTGCTAGTTTCAGTGCTGGAATACCAGACAGCTGTCATGCGGAGGGACTTCAGCATGGCTGATAAAGTCCTTCCTACCATTCCGAAAGAACAGAGGACCAGAGTTGCACACTTTTTGGAAAAGCAGGGCTTCAAGCAGCAAGCTCTTACAGTATCCACAGATCCTGAGCATCGCTTTGAACTTGCTCTTCAGCTTGGAGAACTAAAAATTGCATACCAATTAGCAGTGGAAGCAGAGTCAGAACAGAAATGGAAACAACTTGCCGAGCTTGCCATCAGTAAATGTCAGTTCGGCCTGGCCCAGGAGTGCCTGCACCATGCCCAGGATTATGGCGGTCTGTTGCTATTGGCCACTGCTTCTGGAAATGCTAGTATGGTGAACAAGCTAGCAGAGGGTGCGGAGAGAGATGGCAAGAATAATGTGGCATTCATGAGCTACTTTTTACAGGGCAAGCTTGATGCTTGCCTGGAGCTCTTGATTAGAACTGGACGACTGCCAGAAGCTGCCTTCCTGGCCCGGACTTACTTACCCAGTCAGGTTTCAAGGGTGGTGAAACTCTGGAGAGAAAATCTCTCAAAAGTCAATCAGAAAGCAGCGGAATCCCTTGCTGATCCAACAGAGTATGAAAACCTTTTTCCTGGACTAAAAGAAGCCTTTGTTGTTGAAGAATGGGTGAAGGAAACACATGCTGATCTGTGGCCAGCCAAACAATACCCACTTGTCACGCCAAATGAAGAAAGAAATGTTATGGAAGAGGCAAAAGGCTTTCAGTCCTCAAAATCTGCAGCTCAACAGGAACTTGATGGGAAACTGTCTCCTACCCCGGTTATCATGGCCTCCCACACAGCCAACAAAGAAGAAAAGAGTTTACTCGAACTGGAAGTAGATTTGGATAATTTGGAGTTAGAAGATATTGACACAACAGATATCAACCTGGATGAAGATATTTTGGATGACTGAATGTAATGTTTCCCATTTACTTGACTAGACATAATTATTATGGACAGATATTGATCATCACTCTGACCGGTGTTTTGGACTCTGAAAAACTCCTTAGATTTTTATATGTAAATGCTCTGTGTGGCTCACTGGAATGTAGTACCCTCCTTGTCTCAGAACTTTATGTGCAGCATCTAAATCACTATGCTTCCTTGTTAACTAAAACAGACGTGGGCTTTGATTTTTTTTCCATACTGTCATTATACCGTATTTCATAAAGCCT