Transcript asmbl_22165

Sequence
Transcript Sequence for observation asmbl_22165 of TGE0004233:
GCTGCTTCAAGTGATAATATTATGGTCCAGTACCATGCATTGGGAGTCTTGTATCACCTTAAAAAGAATGATCGCCTTGCTGTTTCGAAGATGTTGAATAAATTTACTAAATGTGGTCTCAAATCACAATTTGCTTACTGCATGCTGATCCGAATTGCCAGTCGCTTACTAAAAGAAAATGAAGAGGGTCACGAAAGTCCACTCTTTGATTTCATTGAGAGCTGCTTGCGAAATAAACATGAAATGGTTATTTATGAAGCTGCTTCAGCTATCATCCATCTACCTAACTGTACTGCAAGGGAGTTGGCACCTGCTGTTTCAGTTCTTCAGTTGTTCTGTAGCTCTCCTAAGCCAGCTTTGAGATATGCAGCTGTGAGGACCTTGAACAAGGTGGCGATGAAGCACCCCTCTGCTGTTACTGCCTGCAATCTGGATTTAGAAAACTTGATCACAGACTCAAACAGAAGCATCGCCACCCTTGCCATTACTACACTCCTCAAAACAGGAAGTGAGAGCAGTGTGGACAGGCTCATGAAGCAGATATCTTCTTTTGTGTCCGAAATCTCAGATGAGTTCAAGGTGGTGGTTGTGCAGGCAATTAGTGCTCTCTGTCAGAAATATCCTCGAAAGCACAGCGTCATGATGACTTTCCTCTCCAACATGCTCCGAGACGATGGAGGCTTCGAATACAAGCGGGCCATCGTAGACTGCATAATCAGCATTGTGGAAGAGAACCCAGAGAGCAAAGAAACGGGCCTAGCCCACCTTTGTGAATTCATCGAAGACTGTGAACACACTGTTCTGGCTACTAAGATTCTACACTTGTTGGGCAAAGAGGGCCCCAGAACGCCTGTCCCCTCCAAATATATCCGCTTTATTTTTAATAGGGTCGTACTGGAGAATGAGGCTGTCCGAGCTGCTGCTGTGAGTGCTTTGGCTAAATTTGGGGCTCAGAATGAGAATCTTCTCCCAAGCATCCTTGTACTCCTACAAAGGTGTATGATGGATACTGATGATGAGGTACGGGACAGAGCTACCTTCTATCTGAATGTGCTGCAGCAAAGGCAGATGGCACTGAATGCTACATATATCTTCAATGGTTTGACAGTTTCTGTTCCAGGGATGGAAAAAGCCTTATACCAGTACACATTGGAGCCTTCAGAAAAACCATTTGACATGAAGTCTATTCCTCTCGCTATGGCTCCTGTCTTTGAACAGAAAGCAGAAATCACACTTGTGGCTACTAAGCCAGAGAAGTTGGCTCCTTCCAGGCAAGACATTTTCCAAGAACAATTGGCTGCTATTCCTGAGTTTATGAATCTAGGACCCTTGTTCAAGTCTTCTGAGCCTGTTCAACTTACAGAAGCAGAAACAGAATATTTTGTTCGTTGTATTAAGCACATGTTTACCAACCACATTGTGTTCCAGTTTGACTGTACCAATACTCTCAATGACCAGCTACTGGAGAAAGTGACAGTGCAGGTGGAACCATCAGATTCCTTTGAAGTGCTGTGTTACATTCCCGCCCTCAGCCTCACATATAATCAACCAGGAATATGTTACACTCTTGTCCGTTTGCCCGATGATGACTCTTCAGCAGTTGCAGGCACCTTCAGCTGCACCATGAAGTTTACTGTCCGGGACTGTGACCCTGACACTGGGGTCCCAGCCGAGGAGGGGTATGATGATGAGTACGTGCTGGAAGATCTTGAAGTGACTCTGTCTGACCACATTCAGAAGGTCCTGAAGCCTAGCTTTGCTGCTGCCTGGGAAGAGGTGGGAGATACCTTTGAGAAAGAGGAGACCTTTGCCCTCAGTTCTACCAAAACTCTTGAAGAAGCTGTCAGCAACATCATCACATTTCTGGGCATGCAGCCATGTGAGAGGTCGGATAAAGTACCTGAGAACAAGAATTCTCATTCCCTCTATCTGGCAGGTGTGTATAGAGGTGGCTATGATTTATTGGTGAGGTCAAGGCTGGCCTTAGCAGATGGCGTGACCATGCAGGTGACTGTCAGAAGCAAAGAGGGAACACCTGTAGATGTTATCTTGGCTTCTGTTGGATAAGTTTTTTGGGGGGATGGGGCAAGATGAAGTTGATGTACACTTCACTGCAGTGGGCTTTTAGGGCTAGTGGCATGAATTTCCCAGAATCATACTTTGAAAAATTAATGACTTTGCAGAAGCAAATTAAATGTTTGGCCCTGAGCCAGCAGATCAAGCAAATATCTGTCCTTGTGCATGTCTTTTTATTACACTTGGTCAACTTTGGTATGATAGTACAGCTTCGGGTGATCTTGAAAAGCAAATACTATCCTGTACCCCAGCTGCTTAACTTCATTATATTGTTTAATTTAACGTGTGTCTGAAAGCTCCTGGCAATGTTGAAAAGCTTTTATCCCAGAGGGGTGGTGG